Description :
From Genome Similarity Track
Location :
contig_24:762293- 764245
Transcript NameFunction/comments
g4686.t1hypothetical protein

Sequence
1952 bases(100 bases per row)
TTGTCCTTGCGCTTCTGCCAGTGCCAGCCATCCTTCTTGTAGTCCGAGACCTCCAACGTGTTGTAGAACAGCAGCGAGCCGCCTACCAAGCAAACATTCA
ACAGTGAAGACGAGCGCATCATCGCAACATGGCGTTAGGCCTGCACAATTAAGTAGCGCGACCAACGCGACGGGAGACCTACTTGGCGGCCGCAGCTGCA
GCGAGTGGAGCACCGGCACGCCCACCAGCTTGCAGTGCAGCAACAAGAACACTAACTCGTCCTTCACGAGCCAGCGCCGCGTCGCTTCCTCGCGCAGAGA
GGCCGCGCGCGCCTGGATGCCATCGCCCAAATTCATTCGCCGCCGTAACGTCGTCTGGCGCCTTGGCTTCAAGAGACGACGAGTACCGTGAGTTTCATGA
TTATGTCCGTCGCAGTGTCGCAAAACAGGAGCAAGTCATCGAGGTCGGCTGCAGTTTGCTCCTGGCTGTTTAGGCTCTAGCTTACATGTACTTTGCTCCG
TTTCCAAGGGTAGTCTCTATGTGGTGTACGCGGCCTGGAGCCACGCCGCCAAAATGCGCCATTTGCGCGGCAGTGCGCTGCTTCTTGCTGCGCATTTTCA
TCGTGTGCCAAGCCACGCGCTCTGGGTCCTTGAAGTCGGCCACCTGCCAGACCACGCCCGGGACTCGGATGAGCTTCGCCCTCGTGGGGGCTGGCGTGTT
AGCGAAGAGCTGTTGGTACATTGAAATGGTCGAGACTTCTTCGTCACCTCCGGCGGGCCCAATGCCCTCCACTTCCAGTCGCAGCGCGTCGCCCATGAGC
GCAAACCCGATCTTGGTCAGTTGTTGCAAGTTCCACAGCGCCAGAGTGTTCCACGGCGACGTCAAGCCGCTCAGCTCCAGTGGTTGTACTGCAGGGTCGG
GTTGGAAGGCGTGCCCGGGCAGTGCCGTGCCCACGACGAGATCATGTTCAGGATCGAAGTTTGAGCGTAGCAACGCCACTCCAGCAGCATCGACCTCGAT
TTCCAGAGACTGCAGTAGCAGCGTGTCAGCGTCGGGGAAGTGGTCAGCCGCTGTGCCCACCAGAGCATTCAGTGCCGGCACAAACTTGCCCCAGTAGAGC
ATTGGAACAATCTCCACCTTGCCGGCGAGCAAGCCCGTCGCCACTTCGTTCTGTAGCTCCGTCATGAACTCGCGCACTGAATCAACAAAGGCGCTTGTGA
TTTGGGAGGATGTTGGCGAGATCGAGTCGGCAGCGCCCGAGGCAGGTGCTCCGGTGATCGTTGTGGCAGTCGCAGCTGGCTGCCCCACAGCGATGAGGAT
GCCGCCATCCGCGTACGTCGCTGCACGGGCGCAGAACTCGCGCAGTTGACGCAACAACTTGTCAACGTCTACCCGCTCGTACTGGGTGTGACTTTGCCAG
TGGAGCCGCGTGCCCACCACCGTCGTGCCCGTCATGCTGTTGCAGTGTCGAGTGCTGCTTGGCGAGTGTCATGGAAATGCGTCACATCGCGCGGTATCAG
ATTCAGAAACGGACATCGAGGTCCTGCTTGTATTGTATTTCACGGATGGTGGTTGAAAAGCTAAATGGGTAGACCCAACTTTCAGCTTCACGCCTCCAGG
TGATGCACACGTCCAGGTGCTACGCCAAAGTGAGCGATTTGAGCTGCTGCGCGTTGCAGTTTGCTCGCCATCTTCTTCTGATGCCACTCGAGCCGTTTAG
GGTCCTCCAGTCCGTCCACTTGCCACGCGATGCTGGGCACACGCACCAACTTCGCTGTTGTGGGCGACGTGCTGTTCGCGTAGAGCTGCTGGTACATGGC
GATGGTGGCGACCTCTTCAATGCCCGCAGCAGAGCCGATTCCATCGACCTCGAGACGCAATGCATCGCCCATCAGAGCGAAGCCGACCTTCGTCAGCTGC
TCCAGATTCCAGAGCGCGAGCGTGTTCCACGGAGATGTCAAGCCGCTTAGCT