Description :
From Genome Similarity Track
Location :
scaffold_786:7620- 8757
Transcript NameFunction/comments
g10267.t1 conserved hypothetical protein

Sequence
1137 bases(100 bases per row)
CTCTTGATGCGTACAATCTCCCCATCAAGCGCAGACGGCAGTCACGAACGTAAACACAGGTAAGGGTTTCATTTTGTTTTAATGAGTGGGAGATAGTTCA
CGCTGTCCAACTCGAAGAGTACCCTGTTCACTTCAACACTACGCTGAGCCGGCAACACTTCCACTTCCACTTGCTTTACCGATTTTGGATTGATCCACCA
GCACCTTCGTGAGAACAACTCCTCCCCCAAGATACGCGGCGAGGATGGTAGCCCAGGCCCATTTGGGTAACGGCTTCCTGCTCTTCATCTTGTCAATGGC
ATCTAGAGCGTCTCGCCCCTTCCGCCCCTGCCCCATGATTACAGCTAGATACGGCGCACCCGCCCTCTCTTCATCGTCGAAATCCTGGTTTCCCCTGAGA
TGGCGACGTTTGTTTCCAACGTCAGTAAGAGGGCTGTCCGACACAGGAGGAACTGTACGGATCAGTGTAGTGTCTTCAGCTCCAGTGACGCTGATTCCGA
GTGCAAGGATTGAAGTTGCGAGGAGCGTCAGGATGAAGATCAAACGCATCTTTGCTGGAGGGGTTTTTGTGGACGAAAAGAAATTCTAGAATGACCAGCT
CACGCACGGCTGAGTAGATTCAGTGTGGCGTGATAACGAAAAAGATAAGCTGCAGGCATCTGCACAATAACAACTTGCAGTAACTACTCATTGCATACAA
ACTGCCTTCCTTCAGAGTACAGTACTGTAGTACATGTACCTGTATAGTCTCAAACGGAAAATACTGGAGCTGATTAGTAGGTTTAGTCTTCTACGAAGCA
CATCATCTTCCGAGTACCGACGCAGGTACACGTAACGCAACTTTCAATTATGATCGATGTGAAAACCCGTTTTTCGTACTGTACGTAAGTAGTAATAGCC
AGCACATTACACCGGCAGTTTTTTTTTCTTAGCTTTATTTAACAAGGAAAATAGGGCTAACCGTTTCTGACGACACAACCTCTCGGACGAGAGAAAGCGC
CACCACTTCAGAAAGTAGTTTTAAATGCTCTCGTCTCCTTAGAAGCGACAGCCGGTGGTTTCAACGAGACAACCTCTCGACCACCTGAGAGTGAGAGGAG
CAGGCAACACTTCAGATATAGTTTCACAACCTCCTTG