Description :
From Genome Similarity Track
Location :
Scaffold_191:762- 3205
Transcript NameFunction/comments
Pytir_DAOMBR486fgenesh_masked-pir_contig_191-abinit-gene-0.45Deoxycytidylate deaminase

Sequence
2443 bases(100 bases per row)
ACACGTACTACAGTCTTGGTAGTTATTGAACGCCCTGCTGATTCAGGGCCGTTGTGATGAATGACACGCCTCAAGGTGGAATGGCAAACTCCCGTCGAGG
AGCTGAAGAGCGTGTTCGTCAGCGTCAACGTGCACAAGCTCCTGAAGCACAGGAGCGTCTTCCGTCAGTTTTCCTCCTGTAGCACAGGAGGACCGTGATG
GAGAATGAGACGGCAGTGGTGAGGAGCAGCAGTGGGGTCTTGATGGCTGGGCAGGAGTGAGCTGGTGAGCTGGTCCATTTTACACCTTTAAATTGTACAC
CAAAATTACACAATGGATTGTTGCTTGTGCAAGTATTTGCATTGTTGGATCCCCTCTGATTGGTTTAAATCCATCTCGACTTCCTTCTCATTGGCTCACG
AGAACAATAATGGTGAGCCATCAATAATATTGGCGCCACTTGATTGTAATTCCCCCACAATATTTTGCTAGGCTTGGATCGAAGAGCAGCAATTCTCAAG
TAAGCAGTCATGACGGAGAAGAAACTTTCGGGGCGGCAGATCAAAGACCTCTTCTACACGGAGGTGAGCTCCGAGACGGACGAGGCCGGCAACGAGACCA
CCACCACGTTCCGCTGTCGCTGCGGCAAGCTGCGCGCGCAATCGCTCAAGCATGGCTACACGAACCTGACGCAGCACATTTTGATGAAGCACCCCGAGTG
GGTCACGGCGCTCATGGAGGACCTCAACATCATCCCCAAGGCGTCGGTGGCAAACCAGCCGTCCCCTAAGAAAGAGAAAGGCGGTACTGGAAGCATGCGC
GCGCTTGGCTCGATGATCAAGCACTACCGCGAGATCCGCACGAAACCTGAACCGTCTGGTGATGGTGTAGCGAATGGTGGGAATGGCGCTGCGTCCGAGT
TGGCTTCGACAGATAGTGCGAGCGTGATAAATGATGGAGCGAAGGTGGCCGAGCAGCAGCCACAGCATCACCATCCGCACTCGAAGCACGCAGATCATGC
ACACAACCATAACCACAGTGACCAGCAACAGCAACGTGTGGGTGAAGATGGTCGCCAACAGGAAACCCAGCAAAAACAGCACCAACCACCGCCGCCGACA
ACGTCCATCAACGACGTAGCGGTGCCGCTTTCGGCGTCTGCTATTGTAGGAGATGCTCCAAACGCACCCGTGTCAACTGCGGAGAGCATCCATAAGCGAG
AGGACTACTTGTCCTGGGACGACTACTTCATGAGCGTCGCATTCCTCAGTGCAATGCGCTCGAAAGGTATACTACTTATGATAAGTCTTTTGGAAGCCAA
TTGTATTGAGCTGACGCTTGTGACGCTAACTAACTATGGTTGTATTGTACGAATGATGCGATTCTTTCGACTTTAGATCCCTCGACGCAAGTTGGTGCAT
GGTACGTAACCGGAAAATGTTCTTGTACCATTGATGGTTCACAACAAACTTCTCACAACAGTGCTGTCTTGATTCTATGGACTTCTTGTTATTATAGTAT
CGTGAGTCCCGAGAAGAAGATCGTGGGTATCGGCTACAACGGCTTCCCGAACGGCTGCAATGACGATGAGCTCCCGTGGGCTCGATCGAGTACCACTGGG
AGTCCGCTCGACACCAAGTACCCGGTAGGAGCAGACACACACGACTGTTTATTGTCAACCCTCACCACGACTATTTCTGACCCATTATCTCTCTGCCTGC
TTGAACTGTCAGTACGTGTGCCACGCCGAGATGAACGCGATCCTGAACAAGAACTCGACGGACGTGAAAGGCTGCACGATCTACGTCGCGCTCTTCCCAT
GCAACGAGTGCGCCAAGCTCATCATCCAGGTACAGACTGTAGCAGTAGGCTAGCGAACGCCTGAGCTTCATCATGAAACCTAACTGTGAAGGCTAACGAA
TGATCACCATGATGCGTTGTTGTTGCTGTTATTGTGTGTAGAGCGGCATCTCGCGCGTGGTCTACTACTCGGACAAGTACAACGAGGACTGGAAGTTTAT
CGCGTCGCGTCGGCTACTCGACATGGCAGGGGTGCGTCGATCTCCATGCCTAATGCATGTGCATGGGCGGTATCGCTAATGCTTGCTGTCTCTATGTGGA
CTGTGTGTTGTATGTTGCTGCTGCTGCTGCAGGTGGCGTACCATCAGCACCGCCTTCAGGTCTCTCAATTGATGATCAACTTTGCGTCCGTTGAATGACC
TAATATTGATATGAAGAGATCTACAAATAGGCTCAAACCCCATTTTCAGCCATCACCACTCTCACCATTTCCATTTCCATTCGACTCTCGTCTATCTATC
TGCCTCTCTATATCTGCGTGTGGATTTCTCTATAGACCTATATGCCATGACGCTGGACAACCTCACGCGGCTGCAAGCAGAGGCCAAGCACTCGAAGCTC
AAGAACAGCCTCGCGAGGGCCAGCGCTGAGTTCCGCGAGCAGT