Description :
From Genome Similarity Track
Location :
Scaffold_737:7617- 11455
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_737-snap-gene-0.1939S ribosomal protein L24, mitochondrial
Pytul_var.sporangiiferummaker-pug3_contig_737-snap-gene-0.15Eukaryotic translation initiation factor 2 subunit beta
Pytul_var.sporangiiferummaker-pug3_contig_737-snap-gene-0.20Zinc finger B-box protein

Sequence
3838 bases(100 bases per row)
TCGCATCTACAGACGCGTGATCTCCCAGTCCTCGACGGTGCGCTCGAGCACATCTTCTGGCGCGGTATCGAAAACACCGGTCTCTGTTCTTCTAGGGTTG
TGACGCTCCTTGAGGATTTCGGGCTTTGGAATGATCGTGCCGGTCTTCTTCGAGACACGCACCTTCTCGCCTTCGTCCGTGAAACGGATCGCCACGCGCG
TTGGCTTTCTGTGGAGCATCATGATATAGAACCATGAGAGTTAAATTATCAGGTCGCTGCATGATGGCTAAATGAGAGTTGGGCTGATGAGGGAAGTTGG
TCTTACCCGATGGATGGATCGACCAAGTTCACATTGCTGTAGTGAATGGGACCTGGCGAAAGGTACGAGCGGCCGGCAGCAACTGGGGTCGACTTAACGT
ATCGCGAGTGCTACAACAAAATAAAGTCAAATCGGCAAAAAGTGAGTCGCTTTTGTCTCAACACGATAAGGAATCTGGTAATCGCGACTCCTGTGCTATT
CCATGCCAAAAATCAAACGTACCATGTTGATGTTTTCCACGATCAACTTGTTCTGATCACGAATAACGCTCACGACCTGACCCTGCTTGCCCTTGTGCGG
TCCATTGATCACCTCCACCTACAATCACAGTGTGCATCACATATTACAACATAGGCATCAGCATATACGTCCATTATCTGCAACCCGTACCCACAGTCCA
TTCTCCAGCGCTGAAGCTGCAAGCGGCGCAATGATACGCCGCATTAATGCTGGCATGCGCACAAAATCATCCCACGAAGTGCACGCTACTAGCACCACTC
CCTTATAAACAAAAAAATACGTACGAGGTCGCCGCGGAACACGTGCCAGTTGTTGATGAGGTCGATGGCCTTGGATTTTCGTCGAGGGCCGCGACGGAAC
GCGAGCGGGATGCGGGTCGCCATGGCTGCTGNNNNNNNNNNNNNNNNNNNNNNTGCTGCTTGCGCTTCTTTCGTCACACACACACAAGAGCGAGCGGCTC
TCGCTTCCCACCAGCAATGCCTTCCGCCATAAAACCTCGCACTTGACCACTCTCACACCAAAAAAAACAACAAAAAAGCAATATTAACAAAAAACCTTAT
TGCTACACCGTACACCTCTCGAATAGCATACCATACCTGAACAGTAGCCTGTATCACGGGTTTGTCGGGTCTTGAAGTTGTCGACCCGGGTGGGTTCGGG
GCGTTTGACCGCGAGAGCCACCAGAAAAGTCCTGGGAACGAACGAACGGGGAGGAGGAGAAACCACGAGCAGCTACACGCGTGTGGGTGGATCAGCAGCC
AAGGAACGAGGGGAAAGGAGCAGCAGAGCGTCCTAAAGCCAAGCCAAGGAATCAGCATGTCGGACGTCGAAGCCGCCGCGCCTGTGGTGAAAGAACGCAA
GTCGAAGAAGTCGGTGCCAGCCGCCGACGGCGAGGTCGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNAAGAAAGAGGTAAATGGATCTTTATGTGTCTACAGAGAGGGATGTATGATGTACTGACATGTGTACGCTGTGTTTCT
CTGTGTGGGGGGGATATGTAGAAGAAGGACGATGAAGCCGACGAAGGTGCGGAGGCCGGTGCGGCAGCCACNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNCAGGACCCTGCGACGTACTCGTACAAGGATGATCTTTTGGCGCGCATCATGTCCAAGTTGCACGAGAACAACCCTGAGTTGACGGACCGCAA
GCGTCACACGATGAAGCCACCGCAGCTCATGCGAGTGGGTACGAAGAAGACGCTGTGGGTGAACTTCCAGGAGATCTGCCAGATGATGCACCGTAACCCG
GAGCACGTGTTGCAGTTCACGCTGTCGGAATTGGGTACGGAAGGCTCGATCGATGGCAACCAACGCTTGGTGATTCGTGGTCGTTACGTGCCCAAGTACA
TTGAGAGTCTGCTCCGTAAATACATTACGNNNNNNNNNNNNNNNNNNNNNNNAGTACGTGTCGTGCCAGATGTGCCGCTCGCCAAACACGACGCTCACGC
GTGACAGTGTCAGTCGTTTATATTTCGTGCATTGCCAAGACTGTGGTTCGTCGCGTTCCGTGTCTGCGATTCGTTCGGGTTTCCACGCCGCGACCAGAGC
CGACAGAAGAGCGGCGCGTAAGTAAGCAAAGTAGGAAGAAGCGTAGACGAGAAGCGGCCAAGCTGCAGTACTGCGGCGGGGATGATACACGAGGCGACGT
TGTTCAATGGAGAGAGGGAGAGTTAAAGACACACGTCAACATGCAAGTATTGCCGCTTCCATTTCTCATTAAAGCCTTGGACTTAGTTGCTTAAGCAGGA
GTGAATGAAGGAATATCTGTCTATTTTGCAAAATACAACTTTGTTTGTCAAACGTATTCTTATTACTCGAGAGCTAGGAGCCACACACATTTATCTCATG
CGCTTTGGCGCTGATCCGCCCTGAGCGCCACCGACGCGCTTGTTGGTCGCTTCAGCTGGGAAAATTGTGATGTGTCGGTCCAATCCATCGCCGACGCTCA
CGTGCTGCAGGCCGAGCCGTTCAGCGCAATCGTGGGCAAGCAATCGCTCAAAGCCGTTCAGGTTCGCATCCAGATGCAGCGCTTCCGTTTGGCCCGATTC
GTAGTACGCTTCGATCTTCTTCACGAGCGAGTGGGAACTTCCAGCAGAAATGCCTGGGTTCGCACTGCCGCGAGTCACTTTTGGTGNNNNNNNNNNNNNN
NNNNNNNNNGTAGGAGCCGTCTTCTTCGGCTGCGCCTGTGGCTTCGCGTCTTCATCGTCCGAGTCGTCTGAAGACGAATCGCTGCTACTAGAGCTACTGG
CTGTACCCGCAGGCTTTGAGGTGACGGCGGCAACACGAGGCCGTTCATCTTCTTCATCAGACGAAGATTCGGATGATGACACAGTAACAACAGTCTGCGG
TGGGGTCTTAGCAGCGACANNNNNNNNNNNTGTGAGGTCGTACTTCGGGACGCTCTCCACGTAAGCAATCTCAGGAACCGCTGCCACTTGTACTGGNNNN
NNNNNNTTTGCGCGGGAGCGGAGCAGCGAGGATCACCGGTCGTTCGTCATCATCGTCGCTGGATTCGGAGCTCAACTCGGCATTGCGCGTTGCCGCTGGC
ACTGGAGCAGCAGGGACAACCTTGTTGTCTTCTTCCTCTTCGTCATTGTCGTCGTCCGAAGACGCTGCGGCATTCACGGCCGATTGCACCGGGATCGACG
ACGGCATGATGGGGCGTTCGTCTTCGTCATCCGACTCCTCCTCTTGTTCAGATTCCGACTCGGACTCACTCGTGAGGTCGTACTTTGGAACACTGTCTAC
GTACGCAATCTGAGGAGGAGCCGCCACCGCCGGCACATCGACAGCCTTGGTCTTCGAGACCTTTTGCTTCTTTGGCGATGGCTCCTTCACATTTTCGACA
GCGACAGCAGCAGCAACAGTTTTCTTCTGTGTAAGTGGCTTTCGCGTGTGGCCGCGCAGGCTCTTGAATTTGTGCACCGAGGCATCGCACTCGCCACAGA
GCACGACGTCACATTGCTCGCAACGCACACTAGATTCAGTTTCCTCGCACTCGTCGCAAGTTGGGTTCTTCTTGATGGCGACTGGTTTAGGTAGCTTAAT
GCGCTCGTGGGCCCTCATGACCTTGGATTTGTGCACCGCGGCGTTGCAACTCTCGCAGTAAAGCGCGTCGTCGCATTTTGCGCATTGCCACGTTGCAACA
CCAGGCTTCTCGCACTCAATACATATGCGGCTCGCGTC