Description :
From Genome Similarity Track
Location :
Scaffold_241:7616- 9052
Transcript NameFunction/comments
Phyag_g3856hypothetical protein

Sequence
1436 bases(100 bases per row)
AGCATCGGGTTCATATTGCTGTGTATGAAATGACTTGGGCCTGGAGCGGGAACGAGAATTCCGCTCCAACAACGCACGCGACCGCTTATTTCCACTTGCG
GGTGGGCCGTATCGACTCTCGCCCCTAGGCCATGGCCCTGAAGGTGGCGGTGCGCCACGGTCATATCTTGCGTAGCGATGGTCATTCTTCGATATTGGTT
GGTGATCTCGACGCCGCAACGGAGTATTACGCGCGCTACCGTTTTGCGATGATAAGGGAGATGGCTCTGGAACACTTCGCTCGCTAGAGCAAGAGCGACG
CGGGATACGTTGGGGCCTCTGTCTGAGGGCTGGAGAAAAGCTTCGTCTAAGTTTCACACCTGCTTTATAGTCCAGTTTAAGTTCCAACGGGTGTCCAATG
TCGTCACGAAAGATATGTGACGCTCGCTCAGCGTCTTCGCGGTTGTAGTAGTGCATATAAACCGTGCCCGGTTGATTTCTCAGTAGCTTCTGCCAGTTCT
CGCGGGGGATATCGCACCGTGGCACGGACTTATTAAATGTGTATCGCTTGCTCAATGAAGCTGCAAACTCCTCACGATCACGGTCCTGGTTAAAGCGAAT
CCCCGTGGACTTGCGCTCGAAACGCGCATTCCGGACGATCAGCGTTATCCCACCGCGCAAATTCAGCGGCACAAATGCCGTGCCGTACATTTTCCGTTGG
TACAATTCTCTGTCCTCGGGTCTCTCGAATCGCAACTCCTCGTAGCAGTTTAATATCCGCGTACCAACCTCATCGTCACCACATTCATCGAGATTTGAAC
TTGCGTTCTCTTTTGCTTTCGGAGCAGCAAGAGATACACCAAAAAACGAAGCACCATACGATTCTTGTTTCAACGCCATTTCGCGTTTCGTCGCACAGCT
TAAACGGGGAATCAGGTCAGGTAGTTCTTTTCCGCCATCATAAACTTCGTATCCAGCCatttgtgttgctgaaccCCTTTTATTGCTCCGAATGTCAGGA
CCCTGAGCTGCCAGCTCTGCCGCTGCCATGAAAATGGAATTGCGCTTTCTGGACAGACGCATCAATGCTCGATTTTGCGGTGAATGCAACAAACTCTTCA
CAGGAACCGGGTTTTTCGTTCGTTTCCTTTGCGGGCGAACGGGGTCAGCCGGTGGCAACTTTGGGCTTGACTGAGGAGACGGTAACGGTGGCATCGCAAC
TGGCACGGGTGGGTCCAACGAGCGCTTATCAGCATTTTCTCGAGTCCCTTCAGTGTCTGTTTGCCCCAATTGCGTAATCGTCTTGCTCCCATCAATACCA
GTCTTCGCAAACGTTCGCTTTGGGATCACAAACGACTCAGCACTTGGAACTTCAGTTGGTTCTTTTTCCTTTGTCACCTTCCTGGGGATTGGCATCGTAT
CCAATagcatctccttctttttGTCCTCGCTGGCTT