Description :
From Genome Similarity Track
Location :
Scaffold_341:7615- 10972
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_341-snap-gene-0.6Voltage-gated Ion Channel (VIC) Superfamily
Pytar_ATCC12531maker-par_contig_341-fgenesh-gene-0.3Chromosome segregation ATPase
Pytar_ATCC12531maker-par_contig_341-fgenesh-gene-0.4Mitochondrial Processing Peptidase alpha subunit

Sequence
3357 bases(100 bases per row)
CGCTCGGCGCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGACCGCGGCGTCGTTGGTCGTAGGAAGCGTTGTGTCCACGGTTGCGT
TCTCCTGAGGTGTTGCAGCCGGGGTAGCCATCAATGCACGCACTTGTTCGCGCAGCGAGTCGCGCATTTGCGTCACTGCCGTGAGCTGGTCTGCGAGCTC
CGTGAGCTGCTCTTGTTGGTGCTGGATCGTGGTCTCGTGGCACGAGAGCTCAATGTGGAGCTCTTCGTTTTGCGTCTCGAGAGCATCCCGTGACTGCATC
ACCTGCTTGAGCAGTGTGATGGTCGGCGAGTCTTTCACCGCCACGGAGACGGCGACTACCGAACTGGAGCGGCGCCGCTCCGTGGACGATGACGTGCTGG
TCGGCTCGTTGCGTTGCGTCCACTTGGCCTGCATCGCAGCGACCGCCGCGAGCTCCCGGCTCTGCTCGCGCTTGATCTCCTGGAGCTGGTCGTTCAGCTC
CGACTTTGTCAGCTGCGCCGCCACAAGGCGACTGTGGAGCTCCTCGGCATCGTGTTGCACGTCACGGTGCTCCACTTCAAGCTCCTGCATTTGCAACACG
ACGCCGTCGTACTGGTGCTGCAGCTCCGCCATGGCGGTGCTGAGCGTTGCGTTCTCGGCTCGCAGCGACCCGTTTTCGCCAGCGGCGATGGTCGCTTGCT
GCGTTGCACTCGCACGCGCCTCGTTGGCTTTCTGGAGCTCCATCTGCAGCTCGTGGCGCTCTGCCTGGAGCTTCTCGAGCTGCTCTGTGGACTCGTTTGT
GCCTTGGGCTCGTTTCTTTTCGAGCTCGGCCTTCTCGCGCTCGAGCGCACCGAGCTTGCCCTTGAGGAGGAGCAGCTGCGCCTCCAAGTGCGAATTCTTG
TGGGCCAAATCGGTCGCCAGCACGTCCGCCTGCGACTCGTTGGCTTTGACGTGCTGTTTCACCTGCGTGAGCACGCTCGACCACTTGCTCACTTTCGGAC
TCGCGTGGGCGTTGAACACCACGCGGCAAGTCGTCGGACTCGCGGGCGATGACGGCGATGTGAGGGCTAATTTCGCCGGCGACTTTTGCTGGGCACGCTG
CGCAGCGAGCACCACGTTCCCAACCGTCTTGAGCTTTGGTCGCGCGCGGGCGGTGGGCTGCGACGACACGTCCGCGAAGGCGATCGCACACCCAGTGACG
CCGGCGCAGGCCTTGGTGATCCGCTGAAGCACAGCATCGCATGGCACGTCCTTCATGTCGACATTGTCCACGCTTCGCACGCGCATCCCCACAGTGATCA
CATGGACATAGTCTCCGATGGCCTTGCACCGCGCGTTGTACTCGGCGACATGGCCGCGAGGAACCGCGTCGATCGATGCCACGAAGCACGCGTAGCCCAG
GCTCTCGGGCGACTCGTCACCAGCAAATGTGATGCCGTGGGGACGCTTCGAGTCGAAGACCACGCGCACCTCTTTCTTAAACTTGGCTTCATTGCGGCCA
GTGCTCCCTTCGCGAAGAAGCTCCTGGAGGCGGCGTTGACGGCTCGCCGCGCCGTCCAGATCGCCGTCCATTCGACTGGCGTCCCATAAACCACCGCAAA
ATTTGAGCACCATTGATGCCTTGCCTGTAAGCGTAGTCGTGGAAGAGTTTGTCAGCCGAGTGGGGGGAGGAAGAGATCGGTATTCATCAACGCTCTCCTT
TTCTTAGCCTTGGACGATGCGCTAAGTTTGGAGGAGAGAGAGAGAGAGAAAGAGAGAGAGAACTTTAGGGGCTCTGGCAAATCTCTCTCTTCCAAGGCTC
GAAAGTAATCCGCACCTGCATCATGGCGTGGTCGAGCCAACTGACAAGATGCCGCTGGAGCAGATCCGCAATGTCCAGGGAGTCATCCAACACGGCGCCC
AAGCCGCGGGAGCTGCTGACTGAATCGTCTTCGCAGACGTCGGGTGGCCATGGCGTTGCGTTTTCGCTTGTGACCAGCGTCGTGCTCTAGGGAACGAGGA
TTACCAGCGTGTCTTTCTGTATGCGAGGCTCCCTACAGCCAACAACCAGACATTGCAGATAAAAGGGTTGACCTGTTATTCTATCAAGGACGTGACTTCC
TACGGCAGCCTGCGCATGCCCTCCTCAAGCCCCTTGAGCACTTGGTCGTACGTGGGGAAGCGCCGCGCGTCGCCATGGTACACGACGCTGGGCCGGTGGT
GCTCCATGGCGTCGCGCAGCACGCGCTGCAGGTCGGCAGCCGTCACGGCGTCGATCTTGGCGCAGACCGACTCGGGCGACTCGCGCGCGCCGTACGTGAG
CAGCTGCCGCCCAATGTCTTCGTACAGGATCATGCGCGACTCGAGGTTCATGAGCACGCTCGACTTGAGCTGGTTCTTGGCTCGCTGCAGCTCGACGCTG
TCCACGGGCACGTTGCACACGTGGAGCAACTGGTTGAGCAGCAGCGCGACCAGGTTGCTCGTGTGGGACGGCGCGCCGGCGCCGTAAATGCCCAGCAGCC
CCACATCGTTGTGGATGGATGAAAAGGCAAAGGCCGACTCGACCCAGTAGAACCGGTTGAGCACGCTCGTGTAGAGTCGCGAGTACATGCCCTTGCCGGG
ACCGCCCGCCGAGAAGCTGTCGCCGCCGCCCAGTAGCGTGTGCAGCACGCAGACAGGCACGAGGTCGTCGGCGTGCCAGCCGCCCGTGGGGAACGCCAGC
GCCACGTACGAAAAGTCCGTCTCAGGCTTGTCCAGCACGTGCAGCCCGCCACGGTACTCGACCGGACTCGGCTTGGACGCCGGCGGTGCGTACGACGCGC
GTGGGTCGCTTGCTGTGACGTGCGCGAAATGGGTCTGCGCCAACTGCACGAGCGTCGCGTGGTCAATGCCCGAGCCGGCCACGACCATCTTGTCGGCCAC
AAAGTGCTTCTGGCGGAAGCGCTGGACCGTCTCCACACTCAGCGCGCCGATCTGGTCGAGCGGACACTGCAGCGGCCGCCCCAGCGCTTGGTCCGCGCCG
TACGCCGCCAAGTGCACGTACTCTTGCAGCAGCATCTGCGGGTTCTCCATCAGGTCCTCGGTCTGGATCTGCATAATGGTCTTGATGGCGTCCAGATCCT
CCTCCGACGGCTCGACGTGCAGCACCGAGTCGGCCAGCAGCTCCACGGCCTTGGCCACATTGTCGCGCAGCACGTCCACCGTGTAGATGATCTGCTCGCG
GCCGCACGACGCCGTCGCGAGCGCGCCGATGCTCTCCATCTCGCGCACGAGCTCGGCGTGAGACCGCGTCGGCGTGCCCTTGAAGCCCAGGTGCTCGAGC
AGATGCGTCACGCCCACTTCTGACGCTGTCTCGCACCGCGAGCCGGCGTCCACGAAC