Description :
From Genome Similarity Track
Location :
scaffold_96:7614- 9832
Sequence
2218 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACGACGATCT
GAAGGGgccgacggcgtgctttgagtttggcaaactcaaaccgaacGTGGAGCTCCACATGcacatccacttccttgtgaatCAACggtaaggcatacag
tgatgAAAGCTTTCGgggccgttgcacccatcgctcaaagagcgctccgtcatctgtagcgcttttgccaggggcgagcactacaggtatcgtccgcatt
gcgggtacacgagagccacctcgttgtgcacgtagacgagtgcgataaacgtccaacggaaattcttgtgggaacaagaaacgagctcgaagagctttcc
gttcggcaaacCCAGCTTCCGTGATGGCCGGTAGCCCAATGATggggacgcgtaacgatcgaataaccgcgtccttcgcttccacagcgggatccgccgg
gcgggagccatattccacacaagcGTCAATGcctgaccgtggatgggcgcgcatcagagccgccttacgggtaGCTTCTAGCTTCTAGCTGTCGCctttg
tgcctcgtcgaggttattggtgatgacaccatgTTTCTCAGGTGATGAaaggtcaggaaacggacatggggttcgcaaggcgcgagcagggctcgtctca
cgccgctggcgcggctcgccttcctcgtcgatccacccgggaaaaggagtgtcagactcgtagtcgaccacctccacatcccaacgaggtcactcgtcac
tgatagtgTGCatggagcgcgacgctcgggctcatcgagcctagaatttacatccctcgatgccgcggacacacggtccgacatggcaccgcgtgcgaag
acgaagttgggctctgcccgtgagcgctgtcagaaccagcaagATTCGGAGATTTtggcgtcattgacacagcgTTCAttaagcacggaagtcgtttcga
taagttgcagtgtctaacggacacgcaagcctcgttgaggcaataatcgattggaactttaaatgttctcaatcttcatgggaagagtgtaacggggtta
cacatacccttgtaACAggagtgtgtgtcacaccagatgggcatagtgtgaccacacacaaacaagaatacggcacAGGGCtgaatagccagtagttata
catatatttagattttactatacatatttaggaaattctttgcatttaaaattaggcggctttgccgcagatgacactaaaaaaacattttttgacTTTa
tacggaagagttaatttccgtgggttaaggttgtaattattcttggagtaagcggattgcgattcgctaaacTCGTTCTTGttccaagtatagaacgaaa
gatcggtgacctaacttacgcttcctctaagctcaaagctacggcagccccgctgcaatggcTGTCAAATAATTACGAGTCAAGCAGATAGAGCTCAAAA
TTTGTTGTGAGAAGCATCTTGTGAACTCGAATGCTCTTTTTGCAGCTATAATTTGGCGGAATTAATGGCGACAATAGCATAGTTACGCCGTCGGTACTAG
CTTAAAGTTCATCCCAGATTACGGCAATAACGAGGTGTTACTAATGACACAAAGTTCCCGATCCGAATTATACTAGACCGTCATTGTTTGATTTGCACAG
AAGAATGTTCTTTTCGGCATATGAATCCGTCTCTTTGCTGCACTCAAACGCCATCTGACCAGGTGTGCCGTGTCGGGCCATTTTGCATATTATACTTCCA
TCAAGAGAGCAATAATTT