Description :
From Genome Similarity Track
Location :
Scaffold_65:76121- 78390
Transcript NameFunction/comments
Physo_138600hypothetical protein

Sequence
2269 bases(100 bases per row)
ACTACTTCTAGTACGTCTTGCGTGTAGCCAGGGGCAGGATCGCGAATTGCGGGAGTCTAGAGCAGACGCTGGTGGTGCTCGATCTTCGCATTGAGATCGC
CTGAGCGATGAAGCGCGCGTAAGCGCTGGAGGACAGCGCCGGAGCCACGTGATGTGATGTCACGCTCCGCAAGAAAACGCAAGATGGCTTCTTCCGCGCG
CTTGCCCAAGTCCAGGACGCGGTCGAGTCCAGCACGAAGCCGTCCTCCAAGAAGAGCTTCATGAAGGCTACCAGCAGCTTCGCATCGGACTTCTGCTGCT
TGGAGACTGCCGCCTGCCACATCCGCGGCTCCTGCGCGTACCACGCGAACCACGTTGCGTGAAGGTGAGTGGCTGACGACCGGCGCTGCTTCTTCTTTGG
CTTGCTCACCTCTGTGTTTGTGCTGTCGGGCTTATTTAGCTTGGCTGTAGCTTGTGCAGGATCACCGTGTAGCTTGGCCTCCAGCGCGTCCATGCGTGCG
TCTTGGCGTTGCGAGTGCTCGATAAAGTGGTTAATGACAGTGGCTTGGTGTCGAATGATCTTCTGGGCTTCGGTATCTTCTATCGGTTTGCTGGGCTGGG
TTGGTGGTTGCTCTGTGGTGCTGGCTTTCTTGTTGCAGTTTGCGGCGCGGACGCTAAGTGAGTCAACCAGGCGAGGAGGCCGGCGATGAAGCTGCCGCTG
TGGACAACGCAAGCTTCGATACGCTTGATCGCAGCAGCTTCTGGATTGAGCTCCTTCAGTACCGGGTAGTGTCGAAGCACACAAGCGGTAAGTACATCCA
GGACGGGCTGATTGACATTGTACCTTGCCGTCTCCAGGTCTTGACAGGCCGCGAACAGAAGTCGCTGAGCCGCGTCGATCTTCGTCCGTGTCTGAGAGTC
GAACGCCTTGAGCTGCTGGATTGATACCTTCGCCTCCGCATCCCGACCGCTGAGTATCTTGCTGATCTTGTGGTCTTGCTCACTCGTATTGAAGATGTAG
TTAAATCCCTTGTTGGTTGTCGTCATGTTCGAGGCGCCGCAGTCGAAGATCCAGCGAGCCGTCTAGCTTCCGGAGGCGTTTGCGTGCTGAGCCCCGCCCC
GCCGAAACGAGTGCGATGTCAGGGCCGCGACAACGCCGGCAGGTTTGGAAATGCGGTCGAGGACGCGGTTGACGTGGGTGTAGATGGTCGGGGTCGTGTC
CAAGCCCGCGGACGTCGGCGCGGCAAGTCCAAGTGTCGTTATCGGGTGGTCCAGCATCTCCAAAAGCGGCACGTCTGGCGACAGTTCTACGGCAACCTGA
CTTGGCTGCTCGGGGAAGTTGTCGATGACATCGGGTGGCAGTGCTGTCTGCGTGATGATTGCCAGGGCCATGGCCAGCAGCGGGCAGGTGGCGAAATCGG
GGTCCGGGAACAGCGAGAGGCCCTGCTCTTCGGAAGTCTTCATGCGTATAAAGCGAACGAAGAGCATCTCACCAGCGTCTATCGACACGTTCTGCTTGCG
TAGAAGCGCGAGGTCGGAAGCGCGGCCAAACAGGTACCACAACAGGCAGAGTAAGGCAGCGTCTTGGTAGTCACTTGAGCAACTTGCATTAACATACAAA
TACACAAGCATTCTTTTCAGATCGCGCTTTGAGCACGGTGGAGCCTTTGTTATAAAGCCACCACCATCTCTCTTCATGCAAAAGTTGTCAAGCGTTTTCC
CCATTTTAAGCAACCGTGCCTCAAGTGCAGCACGATGCTGTGGGAACTGTTCGAGTAGCCAAAGTTTAGCTTGCAGGTAGTATTGCATCGAGGTGTTTCG
AGCCAACGGTTTGCCTTTTTTGCCCTCGGTAAATGCAAGATACATACCAAACTTATCCATTACGGATACGAAACATTTACCACTATCGTCAATATTCATC
ACTTACATCCTCAGACTTCAGAAACTTCTGAAACGTGGGTACGGCAGTTGCCTTTGCTCGTTTGGTGTTACCAGGCTCTAGTTCCTCTAACCCCATGCCT
CTTGTCGGAAAGAAGCAAAATATGCAAGTGATACGTTGTTGACTTATAGTTTGAATGGCGATACACATATTTTTCAGAGTGCTCCGACCCGATACGTCGG
AACTGCTGGCTTACAGGACTCCCCTACCCCTATCAATTTCTATTGGCTCTTGTGGCTGGTACATCTACAACGATTGGACAATTATTCTCAAACTACATGT
GATAGGCTGTAAGTACATACAAACGTGTAGTACAGTCGGATAACCAGCCATATTCAACCATTTCTTCCA