Description :
From Genome Similarity Track
Location :
Scaffold_157:76115- 82871
Transcript NameFunction/comments
g10594.t1hypothetical protein

Sequence
6756 bases(100 bases per row)
GACGTGGTGGACCCCGGCGGTGTCGATACGACCGTCGGAGTAGCGCCAAGGAGGTATGCCAACACCGGGGAAGACCCCGGTGATGACGGAGGCGTGGGTG
GGGACGAACCCTCTGCCCCCTCGCCAGCAGCCATAGGCGTGGCAGTCGGCGACCGAGGAACGGTCACCGAAGCTCCGGCGGAGCCAGAAGCAGCGGATGG
AGTGCCGCTAGCATCCTGTGAACGTGGATTAAGATGGATGCAAGCACAGAGAGGTCAGGCAAGGCTCGGGGAGCATGAAGAGGAAACGAGGAGCAGGAAA
CGAACCTCTACGGATGCATCAAGGGCATGAAGGGCGGCGGCCGTAGCTCGGTTGAGCAACGGCGAGCGGCGAGCCATCAAGGCGCGATCAAGAGGCGCCG
CGACGCGCACTACTTGCGGGAGCTTGCGTCGAGGCGGGGGCAGTTGTGGCGTTGGGTTTTGATGCCGAACTGTCACGGTCCGGCTGACGTTGCACCTTTC
AGTGAACGGCGACAGAGCGTCTTGATTGGCGGGTCTCATTTCCCGCGCTATAGTGACCGAGGTCTCGGCTGGGTCTAATAAAACCCCGGCCGAGGTTAAA
AGCCTCGTTTGTACCCATTTCGTATCGTACCCTCGGCTGTGTAGAGCCGGCTATACGATTTCCCACAGAGATCTGTTTACACTTGATATTTGTATAGAGA
TATAGGACTAGCCAAATGATGACCTACAGAGGCTCCCAGAGCTGTAGGATAAGAGAAATAAATCAGCAGTCTTCCCCACAAGCCACCAAGGGTCAAGTCC
GTCTTCGGTAAGTCTAGCTAGCTTGTCTTAGGGTCTGGATACGCTCGGCTGCGTGGGATGCCTGTCAGCGAGCTTGAGGTACATTGAACCGAGAGTTTGT
TGCTGGTCAGTCCAAGAGATAGGAGTGGCCGAGAGTTAGGGGCGACGGAGAGTGTCGGTCCCTATATATTGGTGGAACCCGAGTGTTCCCAAGTGTATTT
CACTACCCGCCGAGGTTACCCTCGGCAAACCCGTATTAGGCGTGACTGCCGGTACCCTTACTTCTGAGGGGCTGCGGGGGTTCGCGCGAAAGCGCAATAT
TGCATTCTAGCCCTCGCTCGTGGCTAGTAGTGCAGGTTTTAAGGTTGACCGAACTCAACCTTGGTATACAGAGGCGCTTACAACCAACCCGGTGTAAGGG
ATCGTTCCTGGTCTTCAGGTGTTGATCCAACGTTCGCTGACCTTTCGCGAGGGAAGCGTGTGTTGTTGGTGGGACTCATACCGTTCGGTAGTGAGGTTTT
CTGCGTGTTCCTACACGACAGAGGTCTCGGCTGGGTCTAATAAAACCCCGGCCGAGGTTAAAAGCCTCGTTTGTACCTATTTCGGATCGTACCCTCGGCT
GTGTAGAGCCGGCTATACGATTTCCCACAGAGATCTGTTTACACTTGATATTTGTATAGAGATATAGGACTAGCCAAATGATGACCTACAGAGGCTCCCA
GAGCTGTAGGATAAGAGAAATAAATCAGCAGTCTTCCCCACAAGCCACCAAGGGTCAAGTCCGTCTTCGGTAAGTCTAGCTAGCTTGTCTTAGGGTCTGG
ATACGCTCGGCTGCGTGGGATGCCTGTCAGCGAGCTTGAGGTACATTGAACCGAGAGTTTGTTGCTGGTCAGTCCAAGAGATAGGAGTGGCCGAGAGTTG
GGGGGGACAAGGAGTGTCGGTCCCTATATATTGGTGGAACCCGAGTGTTCCCAAGTGTATTTCACTACCCGCCGAGGTTACCCTCGACAAACCCGTATTA
GGCGTGATTGCCGGTACCCTTACTTCTGAGGGACTGCGGGGGTTCGCGCGAAAGCGCAATATTGCATTCTAGCCCTCGCTCGTGGCTAGTAGTGCAGGTT
TTAAGGTTGACCGAACTCAACCTTGGTATACAGAGGCGCTTACAACCAACCCGGTGTAAGGGATCGTTCCTGGTCTTCAGGTGTTGATCCAACGTTCGCT
GACCTTTCGCGAGGGAAGCGTGTGTTGTTGGTGGGACTCATACCGTTCGGTAGTGAGATTTTCTGCGTGTTCCTACACGACAAGATGTAGCTTGGAAGTC
GAGATTAGGGGTAGGAAAGAAATTCGAATGTGAGTTCCATTGAGTTAATTTTGATTGTCTTACTTCTCTTTTCCTCCTAAAGCACTGCTCCAAATACCAC
CTACTCATCATAAGATGTAGCGGGATGGCTAAATGTTACGGGAAAGGTTCATGTAACGGGATGCAAATCCCACCTTCGACCAATCCTGTTGCAGGATTCC
AAAAGCTAAGCCAACCAGATCGCAGTATTCGTGTAGCTTCAAATGCAGTCCCCATAACCCACGCGACCAGCACGCATAGGACGTGTGACTCGTGGTAGGG
ATCCAGTAAGCCAGTCAGACGACGAAGGGCAATCACAAAAACGGTAGCGCTGACGTGCAGCACAGCGTAGGCTAACGGTGTTGGGACCACGGTACTCAGT
AGCCATGTCACCGTGAAGTGATACTTGTGAGCGGTAGCAGCAGGCGTAGCATCGATGACAACACCACAAGGACTCGATGTACTGCAGTCGATGCTCAATG
TCGTCTGAATTTGCCAAAATTTTATTTCGCTGGTACAGGGCTGATACCTATCCAGGCAACATCTTTCCATTCGCAAGTCCATAGGCAACATTTCCCATCC
ATCAGTAGCTGTCATCACTTTTGATGCACCGGTAATGGAACGGGGTTACATGAAGAGTGCCTGTCACTCTTCCGAGTTGGGTACATCGTGTATCCAACAC
CACTGACACGTGGATGGTGTCCCACAACCACACATACATAAAATATATAGGAGAAACTATAGTTGGCTTAGGAATTGTATTGCACTGCAATACAATTCGC
AGGCCTTGGACAATACAGTTTGGTATTGTACGGCAAGACCGAAACATCAGTAGTAATTACGGCAGTATGAAGAGGAGCAATAATAATAACAGGACCAATA
TCAGTATATTGAAGTTGCATCACGTGCTTGGTTGGTCGGAGTCAACAAGCAACGAGGCGTTCCACAAGCCCCGATTCGCGCGCAAGAACGCCAGCGTTTC
GAAGTTAACAGGTAGCATACACGTCCGTTGAGGGGTCAAAACTAACTTGCACTGTGAGAACAAACGTTCAACCGTGTTCGACGTCGGGGGGACCACTTTG
GTCAGAGGGTCATAGCTGATTGATGACGCACCAGCGTTGCGAGGCTGCTTTCTTCCTTGGAGGATATCGCTGGCGTAGTTATCATCCGAACGCTCCTTCC
TCTTTCCGGCGCTGGCCTCCGGCTCCACCACGAAGCGCTGCACAGAACGGGCTTCGGAGGCATTCAACTTGCTACCGTTACCGATCTTGACCAAGGCATC
TTCATTAACAGGCGTGTGCACAATTTTTGCGCCCAGGCCCAAGTGGTTGACCATGACGGGGTTGTCATCGGCCACCTTGTCAAACAAAAGGCGTACATCG
GTCATGCTTGTGCTCTCGTCTTGAAGTGTCTCGCAAACACTATCCAGCTCCTTGAGGTGCTCGAGAAGGCTCATCAGTTTTTTGTGAGTTGTTCCGGTAG
GGACATACTCTTCAACAGCACCAACCTGTCGAATAACATCTCTAATGCGCTTATAGCGCAGCACCATCTCAAATGTCGAGGACCAGCTAGTCATATTCCG
TTTGATAGGAACCAGGTCCGTGAAGTTCGCGAGCTCCGCCGAATTGTTGCAATGTCGCAGTTGCACCATGAGGTGGTTCAGGGCAGCAAGCTCGGTCTCA
TACGCAGTCAGATACCGGTTTACCGCGAAGTTGTAGCGGTGGCTCGCGCAACCGACCAGGGGCAGCTCCAGTAGCGTAGCAATTCTCTGGTTGGTACTAC
AGTAATCACCAATCAGAAAGGCGACCATCGAGATATTCTTGTTGTACAGATCCAACACACATATGAACATATCAATATGTACTTCAGCATCTTGACTACT
CTCTTCGATGGGCGACAGCGCCAGTAGTCGCTCGCGGCGCTTGCCGTTCATGTGGTACACACAATAGATCGCCACGTAGTGCACTGAAGAGTGGGGCCAA
CCATCCCACATGACGCCAAACATCCTGCCCATCTCCTTCTCAATCAGCGCGCCGACCTTCTTGGAGCACCGCTGCATGGCGGACTTCAACGTCTTGGTCG
AGATGGGCTCCAGGCAAGACATCAACCGCGTAAGCGGGTTGTCCACTTTCGAAATCGGTTGGTTTCTCTCGACAACCTATTGAAGCCATTGGTATCGGTG
CTGGGTTGCCTCGGAGACGAAGCCGAAGCTGATGATGGGAACATCTGACACCCTCGAGTCATTGTAGGTCGTCTCGAAGTCGGGGTGGGTGGAGATGTGA
TGCGACATCAAGCTGCTGTAGCCAGATCCAGATTGCGGCTTACGAGGGGCTGGCACCGAAAGCCACCTTGCCCGTTATTTTCAAAGAAGAATGCGCAGAT
CTCTCGGTTGGGGGCCATCTTGTCGAAATGGGAATTGAATGAAGTACGGATTTGGAGTGCTGCGCGGTGACGTGCTGTCTGCAATTGCTTTCTACGCCTG
CCCGTCAGTCGTTGTGGTATCTAGCCCAAAATGCTACAGAACCGGTATTGTATTGGTATTATTGGGACAATATCATATTTTATTGACTTTGTGTACAGCC
AATAAGCAATTATTGTAGTGGGACAATACAGTAATTACGGTTTTGATATTATTTTTTCCGAGGCCTGTATTGCAGGACGATTTTTAGGTAGCTAACTATA
AATATATCAGTCTACGTTGTTCAAGTCAACCGTTCCCCAAGACCGGGAACTAGTGTATTGCCGTTCACTTGGAGTTTGTATACTCCTAGCACTTCATCAA
GCGCAAGGTGCTGTGTGCCTTCTGTGACACCTAAACACGGATATATCGGTAAGGATCTGGGCATCCGTCTACCCCGACAAATAGTCCTGTTTGCGCTGTG
CTATCAGCACTACGTTGCTTCCTCTCCCAGTAAAATCGATTTTTTTTTTTAGTAAAACATAATATCCTACTGTATTACTGGCGACGCGAATAACAAGTAG
TACAATCATATTTTTAGGCTTTGAATGGCGTTCTGGGTAAGGAAGTCCCCACTGAGAATGACCCTTCTACTTCATTACGCACGGACAATCTGCGCGAAGT
GGACATTGTATTTGTTAATTACGAAAATGAGTGAGTTGGCATGACTGTGGGAAGAGATGGTAGCCTACACAGGAGTCTGAAATTCGATCTGGGCTCGAAG
GAACCCATTTTCTGTAGTAAAAAGTCAGTATACTTATTACGGAGTTAATTTCATGTTTTACGGGAACCTTGTTTTACCAATAACAAGTAATCCCTTCAAT
ATAATACTATAATTATTTTATTACAGGTGGTAGCGGCAATAAGACAGTTATACCTCTGAATTCGATTATAGAGGACACCAATATAAGTGCTGAGCTTTCC
CGAACGAAGTGACGTCAGCAGGGATTGATAATAGTGGAGATTTTGCCCCGTGAGTACTAAGACTAACTATGCGTGTCGCATCTTTCTGGTGGTAGTTTAG
CACTACTATTATAATTGCGCGGCGATGGTTTAGTACTAAGACTACATATCGCGACTATTTGTACTAAACTCAGTGCTAACATCGACTCACCACAAACCTC
GTTTGCTCGACTCCATCCGCTCAATCTCAACAAGATTATGGCGCAGCACGAGCTGCCGTTGTGCGCGCTCTAGTAAGCTCACAACGAACGACCCAGTTGA
ATACAACAGGTTCTTAAAATGTTGTACATGTACAAGAGCTCAACCAAACCCTCGTGATCTGCCTGGATACCGTGCGTATTCATCAAAAGAACCCGACGAT
CCGACTCTTTAGCGGTAGATTGGCGGTAGGATCACCGAGGGAGATGTCTGGCTAGGCATGTAACGAAGCAAGATAAATAAACAGTTTGGATTTTGTTCAG
TAGCGACAAGGTCTTCGTGGAGCAGAAACACCTCGCAAGTTTCGCGATCGACAAACGTCAATGTGCTGGAAGAGTTTCTCTACGTTCCAAACGCTCTTCT
TTTCTCGGTTGCGCATTGTTAACTTGGACAAGGTTTCTTTGCGTTTGAGTTCATCTGTGACCTGGAGCTTAGCGACGTCTGCCCACTCGATGCCGTAGTT
CAGCCAAGTTTTGTTTTTCTTCCAACGTACCGTTTTGATAGATCTGCTTTACTGCAGATGTCATTGCTATATAGGTGATGCACCTTCTGCCCGCAAAATA
TACATGTACTTCGAAGTAGCAGGGAGACGTCTCGTTTCAGTCTTCAAAGCTGAAATCGATCTTGGCGCACTTCATCGTAGTGAGGGGTGGGGATGATCTG
GATTGGACATACATAAATGCATTTTGTGAGCTGATTATCCCAAGCTCCCACGAACTGACAGTACCCCACCCCCACCCCACCCCTCCTCGGGAAACATGAG
CAGAAAACGCGCTCGTTGAGTTGTCGGCTGCTCCTCATGCTATCGGATTGAAGAAGGGAGCTCGAGTCGTGTGCTCGTCGCTCAGTCCTATAATTGGATA
GAAACTGCCACGCCTCGTACGGTAGACACGTCCGTGAACGACTCGTCCTGAAGATGGTCATGTTTGTTTTCTCAGTACATGCACGGTATAGTGGAGCTTG
CAACAGGGCTTATGGATGTTTGCGCCGCTTGTAATGTCGGCTCGAAAATCCAGATT