Description :
From Genome Similarity Track
Location :
Scaffold_380:7611- 9230
Sequence
1619 bases(100 bases per row)
GGCCACGACGTCCGCTTGCGCCGCGTTGTCCTCGTGTGTTTTCCATTGTATCATGTCTCCATCTAGGTGGCGGAGTACTTTCCTCCATTTCCCTGAATCG
GTGCCCGTGTCAGCCGTGTACTGTTGTACGCTCGTTCTGCTTTCGAGCGCTGTGTTTGTTAGCTCCATTGCCATACGGTTGGCTTCTTTGGCGTGGTGTA
GCCATTCTACTTCCCGGAGCCGATCCACGATGCGCCGACTCCTCCAGTAGATTTGTGTTAAATGCCGTGCCTTTGGGGGCTTGCGTTGCCGATGCTGTGC
AATCAGCATCTTGTTCGTGCTCACCACCCATAGCGGCCAGTACCGCTTCTTCTCGCACGCCTTGAGTCCCATGAGGAGCCCTAAGTGTTCCGCTTCCGTG
GTCGTCGGTGACGAGCTGGCGTATGACATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCCGTGTCCACCTGCGGCGTCCCGCCCATAAGCACA
CGAGTCTGCTCAGTCTTGGATGTGGGTGAACCTCATGCACCTTCAGTTCCGGTCGCATTCTGGCCGTAAGTACTCTGCATAAGTCTGCCCCGCCGTGTAT
TGTCTGCACCCACGGTTCCTCAGTGATGGATGTGTGGAAGACCACTTCCACCGGGGAGTGGCCTCTGACCGTCACTATCACCGGGTGTTGGTCTGGGGTA
GCAGTGAACTTGACTTCGG