Description :
From Genome Similarity Track
Location :
Scaffold_232:7610- 9568
Transcript NameFunction/comments
Phymu_g7223hypothetical protein

Sequence
1958 bases(100 bases per row)
CGTGTCTGCCCCGACTAAGCATTTGAAAGGCTGGATTACTTGTGGCAGCACACATCATCTCCTCGAATGAGGCAGATCTGCAGGCCGGGAATGGGATTCC
TTGAGTAATTAGCCATTTCGAAATCAGCACGTGAAGGGTCTTCTCGTTCGCTTTGAAGAATAGCTGCGGTCCCACAGGCCCAGTGCTATCACCAGTCACA
GCAGAAGTAGTAGTGGTAGTAGTCTTCTCTCCAGTCAGGTCCAGAACGTCTCGGGTATCTGCTTCTGCGCTAACAACGTCGTTCTTTGCCTTCAGAGCTA
TTGTCTGCTCAGCTAATACTGCCAAAGAATGGTCCTTATGCTTCGACGTGATGTGGTCCTTGACATTACTCGTGTGCTTGGTGATACTTAAGGCTTCCTC
CCATGTGTAaggcgtcttcttctcccggTCTTTAATCTGCTCACAACAAAGCAGACAAATGTTTCGATAAAGTTTTGCACACGGCTTCCACGGGTTGCGC
TTCTTGTAGGGCTTATCCAACACGTGAATGAGATCCCAAACCGGATCCGTAGTACCGAGTTTTCGGGAATGCGTAACCGATAGCGGGATTCCGAGGTCGC
TCACGGGAGGAGCAGGGGCCAAAGGGACTGGAGTAAGACCAACTCCACCGCGAACTTTAGTAGCCTTGGACTTCGCCGCGTTGCTACTCGTCACCGTCTT
CCTGCGCTTGGCAGAGCGTCCCTCCGCCGTAAAATTTGTTCCTGCGCCGACTTCTGGTGGCGGCACGAAGTCCGAATGTGAGCCAGCCCAGATATTCCTG
GTGGTAGTAGCCGTTGAGGTCGTGAGACGCGTCAGAGTAGTAGGTTCGAGTGGTGTAGAGGCCCTTGTATCCGGGTAAACTTGAAGTACGCAAGGTTGAC
TGCAATACCTACAATTACACTGTTAAATCCAGTTACTTTTGTTAGATTATCGGACAAATTACCTTTCGTTCAACGCCGAGCTATCTCCTTCGAACACCAT
GTTGCACGCATGTGGTGAGTGGGCTTCCAGCATACAATTCATGGATCCGTTTTGAGTTCCGGGCCTTCCACACAACCGGCACCAGCACAAGCCATTCTTC
GAGCTTCGTGGCCCAATGGCGACCTTCACGTATTTTGAAGAATGTCGAGCTTCTGCAAAGAGCGCAGGCAGCCACACAATCTAAGATTGAAAAATGAGGG
TCTATTTGCTTAACCCCAAATAGTATCCAGTAGATTACTATAGTACCGCCTCGGATACTACTACTATTACCAGTTGAAGATGCCGTACAATGTGGTAGTA
TTAGCATTGCTAATCTAAATAGTAGTAATAGTAATAGTAGTCTTTGTTACTATTTCTGCCGATACTACCAACCTCTGCCTACGACCCGGATCAAGTACCC
CGCGTTAAAGTGAAGTGTATCCACATTACTTCAAGTCTCTACATCACACCAAGACGTGCATCCTTCACCGCAAGACTCTTCATAAGTCACCTAGAAGAGC
GAAACCCACctaccgacgggtacacaaggtgagtactacacacagctagattacggatcatcgggggacccctccgttagtcggtgcctgggcgctagtg
gtatTGAGACCTGTCTCAATCGGATTTTagcagatcccgctccaccacaccTGTTCGTTGATCCCGCTTGCTCGTGAGCCCGCAAAATCCAGAGTGAGGG
CTGCTCGCCACCGCCCAAGACAGCTTCTTTCTGGcggctcagcagcttcacggtATCGAGCACCAGATCCTCCGGGGTCCGCACCTGAACTCTTGCGATC
CTTTGTCAGTTGGCGTCGACACTGCAACCATCTTCCTAGCGCCGTCTGCCGCGGAAGCTTGAGATCCATTACAGTGTGGTAAGTCTCGAGCTCATCGGAC
GATAAATTGATAGGTCTCTGGTGTATGTCGCGTGCCTAGCGTCGGCCGCCCTCGTCGC