Description :
From Genome Similarity Track
Location :
Scaffold_835:761- 4892
Transcript NameFunction/comments
Phyag_g8287hypothetical protein
Phyag_g8288hypothetical protein

Sequence
4131 bases(100 bases per row)
AGAGGCTGGAACACACAGAACGCGTTCGAGCGTGTGGGTCTCTTCTTGCGGCGCGATAAAGATGGCGATGCCGTGGCGGGCTTTCGAGTTGTTAACGTCG
ATGACAGGCACCCTACCCAACGCCATCGTGTCGACCGGTGTTCGCGTGGTGCTCGTCACCGTCAACCACGATCTCGTGGTCTCGCTATCGCCTCTGTTGG
CCGTTGTTTCCGAGCCAACGCTTCCAAGCAAATTAGACTGCCTACACATGCGTTCCAATCACTGACGGTGGCCATCTCATCGACGTTAGCTATCAGTACG
TGCTGCATGGTGACATCCCGAGTGTGTTTCTCAACGACGCACTCAAGCTGCAAGTGCGTTGGCGTCGAGGGTCTCTgtggcatcgtcgtcgctgcttcac
CCCAATTTACACTTTTTTCTAGCAAAAAGAGACCCACTTAAGCGATAGCCTCCAGAATCACCAAACTCGAAGAAGTTTGTGCCAACGTCGAGACCTTTGA
ATCCTGCTGGAAAATGTACAGGAATTTCGCACGCTGCTCTCAATCTCTTGCCTATGATATAGCCTTTGGAACAACCGTCGTTGAAGCAACAATATTTTGC
CATCCTCGTTATTCGTGAAAACAGAATTCGAAACAGATTTGAAATCAGCAGGCCAAGATGTTGATTCATTCACAAACGGGGTTCTCTCATAATTAAAGCG
GCCGCGGAGATGGTGGCGGAAGGCACAATTCATCCATGAACCCATCCAGCCCATGGCTCGCGACAATCTCCATATCTGGTAGGAACTTGTTTAGCGGTAC
CAGTGCCGACCCATCTTGCCGCTCCACGACGTAAAGAACTTGACGCGactttttttcttttttcCTCAGATCGTTTAACGAAATGCCGGTATGGCCCACG
AACTCGTCAAAGCTAAAACTCTTTTCACAGCACACACACGTGACACGACGCGCAGTGGCCATGATCTTATGGCGATTAAAAGCCATCCAGCCTGCCTTTC
GTGGAAATGAATCTGCGGGCTCCGGCGTTTCCGATCGCACAACACGGTCAACAAGGCTGCCATTCTGCATGTTCATCACATACTTCGGAGAAATACACAC
CACTTGGGCTACAAAGTCCAAGCTTGCAGCACCGGGCAGACGCGCCGCAATTGAACTCTTGTCACTTCGAGGTTTCGGGCGCTTGAAGAGTGCGAGCGCT
TGAAGCCTGGTAAGAGCGATCTGGGCCGCTTGCTTAGCTGCTTCCTCATCTGCCAAGGTCGGTGCAGGTTCCACAACAGCGGCCTGGTCATCAAGTCCCG
TCGAATTCTTCAGTTTCTCAGCATTCATTAGCTGCTCTGACTCGTTCTCTAGATCACCTTCCCGACTTGCAGTCCCAAGCCCATCTGAAGCCATTTGCGG
TCCACCACCATCATTCACGTTCATTGGCTCGACTTTAGTTTCCTTTGTTGCTTCAGTCAACCCGTCCTGTGTGTCACCTACACCGGCAAGCATATTCACA
GCTTCTGCCTTAGCAACATCATTTCCCTTCTTCAACTCTTGGCCTAAAGGAGACACACCTCGAGACCGCGACGTTGAACGTCGTGTTGGCTGCGATTTAA
TCGCTTGATCATCAGGAGTAGCGCTACGTCCCGGTGCGCGCCGACTACATGATACCGAATTTGATCGACTTGGTGTAGAAACTGGAGGTTTCCCACTTGA
GGCGGAGGCATTGGAGGCATCACTCTTCTTTTtatccttcttctcctttttgCGCTGCTTTTCCAACTCCATGTCGTTCATCATTTCGACGAGTTTGCGC
TGGCGATAGTAGATCAACTTTTCCGGCTGCGTGCACGTCGGGCAGTCGCAGCCCCAGAGATATCCTCCACTTTCATAAAAATCCAGAAATGCCGCTTTGC
ACGACGCACAACGGAAAATATTACCGCGTCGATCTGGCGCTTTAAGCTGCAAGCTCTCCACCTGGTCCAGAATTGGCATATTCGCATCAAGATAAGGCTT
AAAGGCATGGACGAAACAGCCCGCATGATACACACGACGGCACGCGCGGCAGTGCATCATCACGCAAATGTTCGCCACTTTCTTGCAGAACTCACAGTAG
CGAGAGTCATCACCTccaatctcctccaccaattgattctccttcgtcttgcCCTTGACACTCTTCAACTTTCCTTTTCCTTTCAAGCGTAAGTCAGGGC
TAGTGGTCGTGAATGGCAGCGGAGGGAGATCTGTAATGATCGGCGCAGCTTCGTACACCGGTGCCTGACGCCGCTTCTTGcctctctgctgctgctctgc
cCCTGCAATTTCCAGCGTATCCTGCACCACTTTCGACGTCGTGCGCGACTTCTTGGCAGCCGGTTCAGCTCCTTCCGTCGTCCGCTTCTTGGtttgctgc
tcgccctgATCcacaagagcagcagccaccagAATACTCAGTGgctgttcttcctccttGGCTTGTTGAGCCATgccagcattggcagcagctgcagcag
ctcttgacgGTCTTTTACTCGTCGCTATTGGAGCAattggctgctgctttaTAGgctcctctttctcctttttgagcactgcagcagctgtaCCAACTGC
CTTAGCTGCAGTTTTTGCTGTGTTTTGGCCACTATAAAATTTGGCAATCACGACACCCAACGgcacctcttcctctttAACTTGTTCGGCCATATTAGCA
TTGGCTgcggccgctgcagctcttgggAGTCTCGTTCTCGTGTTGGTCTCCATCAATTGACTATTACCACCGTCTGGGACGGTTTGGTTACTTGTACCAT
CTGTAATTGTCACAGTCTGGGCTGTATAGttgctgattggctgaaaatctCCCTTGGACTCTTGAGGCTTGGATGGCGTCTCCTGCGTCTCCTGGGCGGC
TTTCGAACTTGAAACTTGGTCTGTACCTGGTCTGACGTCTtgtgaaggtgctgcaccTGTTAAATCCAAGATCGCGTCCATTCCCAAGGGCACAGAGGCC
TCCGCCAAAGACGACTCGGCGGGCGTCATGAAGCTTTTTGATGGGCGATTGAGGCTTGCGTATCTTCCAATCAAATTCCGTCAAAGCTGATGCATAGATG
CCGTATGAAAGGTTGGTGTGTGGTACACATGGCTGCAATTTTTagaccacttcaacagcaacaactagTTACAGTTTTGCACACTAATTGCTAGGATGCA
CCCGAAGACTCCGTCGACGCCTACAAAAGGACGAGGAAAAAGTCGAGGGCGCAATACTCGTGGACGGATTTCGGTCGTGAAGGTCGTTCAGAGAGTTAAG
ACCCCGTTATCCGGGTCTTTGACTGCTGCAGTAGTGGAGACCAAGACTTCTACAGACGATTCcaatgctggtgcagtgcaTTCGAGTAGTGTTAGTGGCT
GGGCGAGAGAGGAGCAAGGTGGGAGGTTGAAAGGATTcagtcgagcagcgcagtcCATCATCAACATGCACAAGCAGCTCAGtccgacgaaagcgacgGA
ACCAGTGCCACCTCCTCCCAAGCAGAAAGACCCGTGGGCTGCTGTTATGAGCACCGTAGTGCGCAAGGCCAATGGAGGAGATGTGGGTTTGGGTCTTGGG
GGGGGTAAtactggaggcgctgcatcGGACAAGCGCATTTCACTAGCTCAGATGCTTAAAAGTCGAGAGATGAAGAACTTGGTACAGCAAGCGCTCGTCG
CGAAACAACTTGGGCGGGgcacagcagcgccagaagAACAATCGAGAGTGATGTCGCACTGGATCAAATTGTCCACGTTGCGTCGGAAACAACATGAACC
GGATGAAGACGGCGCAATGGGTGGCGATTCGGGCGGAGGTAGAATCATTAACGAtatggacgacgacagtgacaTCGTCGAAGACGTCAATGGTGTGCAT
TCGGgcttcgacttggacgaTACGGCCAAGGGCCATCATTTGTATGGTCGAACGCTTATTCTTGAGGAATCCTGTCGACGTGCACTCGCAGTAGTGGGCG
AACAACGCTCGCAGATGGGCTTGCAGTCGCTCAGTGTCTGGTTCCAGACAACGAAACTCAAGATCTCGACCGATTTCGAGCGGTTGCAGCCGTCGGAGCT
AGACATGCTGTGTCGACGCATGACGTGCGTG