Description :
From Genome Similarity Track
Location :
Scaffold_1483:761- 2171
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_1483-fgenesh-gene-0.0Major Facilitator Superfamily (MFS)

Sequence
1410 bases(100 bases per row)
CAGCATCATTACTCAGCAGCTGCAGACCGCCTATGTGCTCCTCCTAACAGGCTCGGACGAGCCTGTACGGTTCGCCAGGGGCATCCAGGGCTTGGCGCTG
CTGCTGTGCTCCTTCCCTGCTGGCTGCGCGGCCGATCTGCTCCGCCGCGACCGGATCCTCTCGCTCGCGGGAGTGGTTGGCGCTGCAGCCGCGTTGACCA
CCGGTATCGCCGTCGAGTTCGCGTACCTGCCGCTCATCTACGCGAGCTCCGCGCTGTGGGGAGTCTTCCTGGCTCTGTGCAACCCGGCGCTGGAGGCTAT
CTTCGCCGACTCCGTGCCCGCTGGCCAGCGCTCACTGCCCTTCACACTCAAGCACGCCATGCTGAACGTCGCAATGGTGATGGGGCCTCTCAGTGGCGCC
GTGCTCCTCTGGAAGTACGGCGACGTGTGGGATCCCGCGAGTTTGCGTCCCTTGCTCATGTTCGCCGCCTTCCTCGCCGCCGTCTCCATGGGTATGCTCT
TCCAGTTCAACGACGACTTTGCGATCGAGAATCGACAGCGCGTAATGGCCGTCGAGCGAGAGCTTTGGTCCATCGAGCGCCATTTCGACGCCGAAGACAG
CGACTGCGTGAACCCCGACGGCGTTGAAGTCCGTCCGGCTCCGCCTCGATCCAACGCGCAGTCGACTTCGTTGAGAGCGCTGGGATCGCCAAGCGAGCTG
TCGCGTCTTCTGCATTCGCCAACCTCTCCGAGTCGGTGTAAATCGCCGCGTGAGCTCGAGTCGAGCGAAACTGATGTGGATCAGTGCGACGAAGTGGCTG
ATCCGACCACGTTCGACTCCGACATGCCGCCGTCACGACCAACGTCCACTTGCTTCGGGTTGCTCGATACCTCGTCCGTGCCGTACCTGCTGTTCGCGTC
GGACTTTGTCGTGAGCAACGGCACTGGAATGGCCGCCAACATCTTCTCGCTCTTCTTTCTCAAGGAGCTCGAGCTGTCGCCGATCAGCGTGCAAGTGCTG
TTCGTGCTGCAGCCCATGTGCGTCGCGGTCTGCTCGCTCTTTGCCCAGTTCGTCTCGACGTGCTCGGGTCGGATGCCGGTCGTCGTCGCTTGTCGAGCGG
TCGGCACGATCTGCTTATTCCTGATGACGGTGTCCGAGCAAGTGGAACATCAAGGTGCACTCTTTCTGGCGAGCGGCGCGCTCATGCAGTGCACCAACCC
GTTGCGTCAGTCGCTGCTGATGGACTTTGTGTCCAAGAAGTACCGTGCTCGCTGGAACTCTCTCGAGGGACTGTCCATGTTTTCGTGGACGGGGAGTGCC
GTGGTCGGTGGACTCGTCGTAGATGCCTATGGCTACCGAGCCTGTTTCCTGGCCGCCGCCTGCGTTTACGTCTGCGGAGTTGTCTTGGAGACGGCGCTGA
TTCCTCTGAC