Description :
From Genome Similarity Track
Location :
Scaffold_564:7609- 8721
Sequence
1112 bases(100 bases per row)
TAATCAACGTGGGTTCGGATTGGACCGGTTCGGGTTAACCGGTTAATGGGTACAACTGGTACACAGTACCCAAGACCAGCAACCCTCAATAGTCCCTACC
CCTAACTCTGCTGCAAAATGCACCCAGAGAGACGAGCGCTGAATATTGGTAGGAACGAGGTGGGCAGGCTAGAAGGCGTGGCGGTCGCGTCCTCTAGTCA
TCGCATTGCGGTGCTGTGCTTGCCGCTAGCCTCAGACAGGTAAAGCTACCTATTGCGTGTCCTATTGGTATAGATAAGCAACAATACATCTACTCAGGAG
CCCTTACATTAGTAGACGCCTGCACTGAGATATAAGGGGTGAGGCGTCATGAGCTCGTGAGCCTTTAGGAGTAGCCTTTGGGAGCCATGCTCCGCGAGCT
CCGCCGAGCATGGTGTGGAGAAGTGCCGAATAAGAATGGATCTCCGAGAAAGGCGGCAAGGCCGATCGACTGGAAGTATGGGGGATGAGCGATCGAGAGA
CAGGCAGCGAGAGTCTATGGATCAGAGGGAGTTCTTCGGGAGATCTCAAGTGGCCCGATGACGGCGGCGCGTAAGGCAGGACATGTGGCAAGCCGGATTG
TGGATGATCGTGCTCGAACCATGGCGTGATTCGGGGTCGACCCAAGCCCCGATCGACGACAGATCTCGCAGATCTAGGATGGCCGAGGACAGAAGATGAT
GGATCGGCGGCGTACGGCAACCGGCACGAGTCGTCGATCGGGAGTTGATCGCCGATCGCCGATCGGGAGTCGATCGCAGATCAGGAGTCGATCGTGGATC
GGGAGCCGATCGTGGGTTGATCGTGGATCGGGGATCAACCACGATGGGATGCACATGGAGGACGAAGTCAGGACAAGAATCCAGTGGTTGTGGAGTTGTA
GGATGGTAGATGAGATGGTAGCGGTAGAGAGACACCAGCTAAACCTAAATCAGAAGAGAATTTGCACCAAAGACCACAAGTCCCCTCAAGTCACCAAGTC
CCAGGAACTACATTGGCCTCGGCAGTGTCGACACTTTGGGTAGTGAACTAGCGGTACGGTTAAGACTGGATTAATACATTGGCCAGCTTGACCTACTCTA
GTGATCTATCTC