Description :
From Genome Similarity Track
Location :
Scaffold_415:76085- 77512
Transcript NameFunction/comments
Aphin_H310_06173PREDICTED: similar to SNF2 domaincontaining protein
Aphin_H310_06174Hypothetical protein

Sequence
1427 bases(100 bases per row)
TGATGGACTGTTCCTCTTTTGGCTCAGTTTTGACACGTGTGGGTTGACTACGCCGAGATGGCAATGAGGATGCTGTTGATTCTACCCTCGTCACTTTAGC
GTTCTTCGGGACTCGAGCTGCCCTGCTTCGAGGGGCAACGGTGACTTCGTTCGAATCGTCTACTCCGTCGTCGCTACCTCCAACCGCAGTGTCCATGTGC
GTCGAGTCGTCTTCTTCATCTGTTTCTTCTACCATTGAGTTGACCACCTTGACGAGGGGACCAGTTGTTCTCGTGCTACGGCGAAGCGCAGGCGATTTTG
CCTTCACGGATGCATTCGAAGGACGCTCGTGTTGCTTGTCCAAGACTGCCCCTTGTGCACGCTGCTTCTTTGGTGCAGATGCCGTTGCAGGAGCTGCCTG
TTTGCGCTTGCGGGGGGCACGGCTGTTCGGTTCTGGCGCTGCCTGGCTTGGAGCAAGTCGCGACGATCGGCGCTGGGACGTTGTCGCCATGTTTGTCTCG
CCAACGCGAATTCGAATTGAAGTTCAAACGCAATCAGGCGTTGATCGATTATCCGGATGCTCATTTTTATTCAAAGAATGCATCCGCCTACCAAAATCAA
GTGAAAACGCTGTATTTTAATTCTCAACCATTCACGGGGAGGATCTCAAATTGGTGGGAACAGGGCGGTCGTGCCCAGTCGCGGCAAACATGCACGGTCC
TCAACACTCGACGGCACTCACGACATCGACTCCTCGCACTCGTCCACGTAGGTACAGGTGCCCTCGGGAAACTCGTCCACAGGCAGCAGCAGCATTTCAT
CGTCAGGCTTGGCTAGAAACGATGCCAGGTGGTCGTTGCAACGCAGACATACGCGATGGGACCGCTTGAGCAGTGCCTCGCAGTGCGTGGTGCATTGTTT
GCACGCCAGCTACGATGGACGCAAGTGCGACAAGTACTTCAGTTCAAACGACACGACGGCTGGAACGTACCATGTGGCAGACCTTACATTTCACGGTTGG
ATGGTACCATTTCAACTTGGTCGTGCACACTTGGCACAGCTTGGCCACGGCACTCAACGACCCACGTGGGTTCGCAAGAATGGACGATGCAGATGACGAC
TGCCGTCGACGCATGGACATCGACCGCTCGTCTTCCCATGACATCGAATGGCTCATACGCAAGTCGTTCTTGTCAACAAACGGTTGGGATTCGGCTCTCG
CCAACAGTCGACGCACCATGACGGATGCGACCCACTTGGGCATGTTCCCGCAATGGTCTACATTCAAGACAATCGTTCGGTGCAGTTGGCGCCGATCGGA
TCCCTCTATGACGACCGTGCCGGAATGCTTCAACGTGGCTCGCACATGATGTTGCTTGGACGACGAAACAAAGAGCGGAATCGAATGCAGACATCGCACG
TAGCCGCGGCGACCGGACTGCGTTACG