Description :
From Genome Similarity Track
Location :
Scaffold_17:76081- 78373
Transcript NameFunction/comments
Hyaar_Emoy2803046hypothetical protein

Sequence
2292 bases(100 bases per row)
TTGCATGGTCCCAAAGAAAGAGTCGAAGAAGTAACATAGCAAGAAAACTTGAATAATAGGACGTGTTCTGTTGCGCAATTCACCACGCGCTTCGTTGAGG
TGTACAATAAATTTAGTAGCAAGCATTTTGATCACTAGTTCTTTGGTAGCAAGGTCAATCATCCGGTAAATGAGATTTTTTCAAGTTGTGGTTTCAAGCA
GATAGCCCAGACTGCTTAGAAGCACTTGTTCAATCTAATATTACAAACATGAGAACGGTACGAGCTGAGCGAGCCACAGGTGTCATCCAGAAGTCCAGTA
TCGAAGAGAGATGAAACATGTTCATAACAGTGCATACAGAGCTACAAACTCGCCAAGAAAGCGGTGAATTATAGTAGACACACTCTTCCCGCAGCGCTAT
GACGTCGTGAGCTAAGCAACTTCTGCATCGTCGAAAAACAAAGATGGTCGTTAAGAAGGTCTAGCAAGTGCGACTCCAACTCGTTATACTTAAGGCTTCG
CTTCGTCATCAATTGCTACCATCTTATTATTGCAGTATCCTCAGCACTACTAGCTATTACACTACAATGATAACAATCGGTCTCGTGCATATCTCTAAAT
GCACACTGAACTAGTAGAGAACCCTCACAGTTCCTCCCCATTGTCAGAACGAGGAGCGGCCCGCCATACCGTTTCGGCGTTATAAACACCAAGAAGCTTG
TCGCAATCGGTCATCTTCAGTGGCATGGGGACAAGTGTCGCTTCGAAATCGGTGGTAGTGGTGTTTGGAACATTCACCACAAACTCCTGGTTCGTGAGGT
AGCAGCACACAAAGTCATGAAAGTGGTTGAAGGCGTGGACGTGTTCGTCATTATCCATGTCTATGGGTCGCTTTGCCGTACCGAAGAACAGCATTCGAAC
TTCCGGAGTCGTGCCTAGACACATATCACGGAGCGAAAATGTTGGACGATATTGCACGGGAATCAAGCACGAATCTGTAGGCTGGACGGTATCGAAGCTC
AGCGCCGTGCTATTTAACGTAGCATTATTCATACTCCCAGCCAGGATTTGAGCTGTTTTCGCGAACGAGGAGATGAACGGAGTGATGAGCAGGACCGGAA
TATCGATCATGTGCATGAAGAGCATCATCACCATCAGCGCCTGGGAGACAATGACACCTAAACCTCCAAAGACAGCGCCGACACCCATCAACAGCCCATG
CATTGAGGCGAATCCAGTACCCAGTAGTACAATCGTATTTGAAGCAAATTCGGATGGGTGGTGCTGGATGAACAGGAGCGTGCCGCCACCAACGTTTTCG
AATGTGCGTTTCGGGTCTTTCATCATCAACCGGTGCATGGTCATGACGTTCTGGCCAAACTTGTGGAAAAATCCGGACACTTGGCGCATGCCAACACGAG
GGTGATGAAGGGTGTGGATGATCCACTCTATCGCGTCAGCAACCATCTGCACGACCCCAATGACGGTGTCCGACACGATGTCCACCGAGTCCCTGAACAC
TTTCTTGACTTCTTCTGACAACGGCAAGTTCTTGAACATCGCGCTCTCCTGTTTCCGCTCGATTTGGAAATAGTCCCATAGTGTCTTGTTCGGGTGACTC
AAGAGGTACGCCGTCATTGCTGCATCGGCGGCTTTTGCATTCAACTCCCTTTCGGAAAGGAGCTCCTGTTCCTCGGTGAACTTCACGAGCACGGGGCAAA
CGTTGTAGAGATCAACAAGGTCTTGGCCAGACCCAAAGGAACCAGCACTATCGCTTAACGAAGCGGGCGAGTGGCTGTGGACCGAACTGACGCACGCAAA
GAGGAGGAGGTGAACGAGAGTGAAGTGCCACATCGGGTCGACAAGGGAAAAGGAATAGTGACTGGTGACCCGCACTTGCTGAGATCAAGGGCCATTTTTT
CATAAACAGTTCGCTCCTGCCAAGTGAACAGTGTCAGCTCCACGTACTGGACCCCCTAGCTGACGTGCCCCATTTTGCATGCATTTACTCTATCAATGCG
TCGGTCCTTTATCTAATAGATGTAGGTGTGAAGCTGATCGCAAATCGCTTAGTTATAGGGAAGGGTAGGACTGGTGGCTAGCCATAGTTACGTTTGAACA
GGTTGATTCATTTATGTGCCAGAAGCATCGATTCTGTCTGCGTCTGCGCTGACACATATTGTTGACAGCATTTGACGAATGGCTGTAGATGCATTAGCGT
CGGCCAGTCTAAATGGAACTAATGATTTAAATGAGGCGGTTCTTACTTCAACCTACTGTCGTGAAACTGACATCAAACGTTTCTAGCTTTTC