Description :
From Genome Similarity Track
Location :
scaffold_833:7607- 12862
Transcript NameFunction/comments
Pl_102211aspartyl/Asparaginyl beta-hydroxylase, putative
Pl_102212hypothetical protein PHYSODRAFT_563177
Pl_102213hypothetical protein PHYSODRAFT_517690

Sequence
5255 bases(100 bases per row)
CGAATGCGCCTTGATGCTCGACTATCAAACACAAGGATCAATCAGCTATTTTCTTCCCTCATAGGTCCAAACTCACCTCGGGCTTCAAAATAGAGAAGAA
CGAGTACGCAAACGGCAACCCCGCCATGAATCCAGGGATGTTTTCCAAAATCTCCACCGTCTTGGGGCATTGTACTGCAAAGTCCGCTTGACGTCGACCT
TGTGTCACATACGAGAGCCAATCCCACTGCCCCTGATGGAGCTGATGCTCCTTATCGTACACTTTGTAGTCGCTCGCCTCAGCAGCTGCAGCTTCTGACT
CATCGCGCTGCTTCTTAAGTGCCAGAAACTCGTTGGTGATGGTCTCGCGGTTGGCTTCGAGGTGCTTCACCCACTCAAACTTGGACGTGTCATGCCATGG
CGCAGACTCGAGACCGGGGAAGCAGAAAAGTGTAGGAGATGGTCGTGGCTTGGCTGTAGATAACTGTTAGATGGTAAAGCTATTCAAGTATTCGTGAGGC
TACGCACCTGTCGTCAAGCAAAGCGCCGAGCGGAGTAGTGCTGCTCTGTGCGTCATTTTGATCCTCACAATTATGGAATGTCGCTGGAAGGTTACTTGTA
CGCTAGTGTTGCACGAAGAGAAGGCGATGGGCAACTTCAACATGACCTCCAGACAATTCCTGGTCAGGCACAATGCTCCATGAGTGCGCCTATCGGAGTC
TAACGCTCGCTAGAGTAGTGGAGTGACAAGACATTTGTAAAGCTGTGGGTCGTACCGTTCGCTGTCTTCCACTGTCTGGAGCAAGTATATAATGTTATGC
TTCATTATATATGCACAATACAAAACTGTGAAATTAGCATGGTGCAATGCACGAACCACAGTAAAATAGGTTTAACTGCAGCAGAAGCAAGGAATCAAGT
CGAATATACCCTTGCTGATGGCGACATAGGAATGCGAGTTTGCATCTTCTGCAATAGCGAACAATAGTACACGTACTGAACCGTGTTGACACTGAATGGC
GCCGGTCAACAGTTCCGACGTAGGAGTGCATTGGCTCCAGCCAAGAATCAAGAGATCAGCTCGATCGGCTTCATTTCAGTTTCATCGAAAAAGTTGAGGA
TGAAATGCAAACTACACTTCCTGCTGCAGTAACTAGTTGGGGTTCGAAGCGGAATTTTGTTGAGCTACGAGCGTTAGTACTCGATTTCGTTATCAAAACA
CCAGCAGTGCTTTCGCTACCATCTTTGTCAGGAAGCCATGAACGACGACATCAAGTAGGCCCAATTACACTACAAATGAGGTGCTCCATCACCAGCGAAG
AATATCCCCTCAGCTGCCCTCCATCCGTTTTGAAACAGCTTTCATCGCTCCAATACTCAAAGTCGCAGCAAAATAATATAAAAGACGATGGAGTACTCGA
AGTCGTAGCAAGAAATGTAAGCAAATTAATACACAAGACGATGGGGTTGAACAACAGCACTGCTGACCACGCATCACGAAGCCCACTACTCAGTACTCTA
CTGGGCCTATGTTCTTCTGCGAAACCGACTGCGTGTCATTCGTCATCGTATAAGAGTTGCATGAGGCAGCACAGATATCTTCACCTTCACCGCACGGCAA
GCGAAATGGCCATGAAGGTGATCGATCACCACAGGCAGCAATAAGATACTGTAGTGATGCAATTCAAAAGTTCAAAGCGCCATTTGTGTAGATAAAAGGC
GCCTACATCCACCCTTGGCGCCAAATCGACGACACGGTCCAATATGTCGCGCCACGACGGACAACTAGTCGGTTGCTCCTGGCTTCAACGACGACCCACC
AATCGGATGCGCCAACGACCGTTCGCGCTTGATTCGCGCTGCGCCGCCTTAGAAGAATAGCTCTCGCCATCGCGTGCAATTGCCTCATTCTTCATTGTGG
AGGCAGAGAGAACAACAGGTAGCGAACACTCCATGGCAAGAGACGGCGAGGAGAACAAAGACGCCAATGTGTTGACCGATGACGACCTTTTGGACGAAAT
GTTCACGGACCGCAGCACCAGCGAAAAGGACGACGACCTGACGCTCTCCATGGACTGGAGCGTCGATACAAGACGAACTGAGGCTGATCTCGATCAAGTT
TCGAGTCGATCTCGCGCGAACAGTGCGACAGATCGCCTTCCAATATTGGTGAGGGCTACAAGTCAAGGGGCCTATTTCAACGAACATTTTCGTAGTTTAG
ACCCTGACCATACCGTGGGGAGGACTCGGGTACCGTGGCATTCGAAGAGTGTTTCGGATCTAAGAGACCCGGATAGTAAACCAACTCGCATCGTTGCGTT
CGACGTCGGTGGTAAACTCTTTCGATGCAAAGAGAGTTTAATCGCCAAGTACCCACTCAAAAGACTCAACCAGATCATCACTTGTGGTTGTGGCAAGATC
AGTTGCCTGGACGACGCGTTCTTTATCGACCGCAATCCACAGCATTTTGAAATGATTCTTGATTGGTATCGTACAGGGAAACTAGTACGACAACGTAATG
TTGATGAAGAAGCGTTCAAGGACGATGCGATATACTTTGATTTGCACGAGGAGTTGTTCCCGACAACCCCTGCTGGAGATCCGCCACAGTCGTGGCCGAC
GACTAAGGCTCCACCTGGACTACCAACTCGTAGACGTTCAGTTAATGATGTCGATTTGGGACGTAATAACACCAAGCGTGTTAGTATGTTTGCCAACATG
CCATCTCCTCCGGTACAGCGGGTTAGTGTTCAATCACAGAAGAAAGGCGAAGAACTCCAGGCCAATCCAGATAAGGAGAAGATGGAAGACGTAGAACTTC
CTGCAGCTACAGATGACGGATCGTTGCGGTTTTTCAGACGTGAGCGACGTGTATTAACGCTCACCAGCATCCCTTTGGTGTTCATGATTCGTAAATTCGA
GCAGTTGCTGGTAGAGAGTGTGAAAGGCCGAGGTAAACTCATGGTTCGTGTGTGCGATGCAACAGGGATGCAAACAGTGGACGTCCCTGAAGCTGTATTA
TTTGACAGCCATTCACGATTTTATCTGAAAGGAGAACGTGCGCAGCTACAGCACAATGCGTTGCTACCAGGAGATCACGTGTACACGTTTTGGATCGAGG
AAAATGCTAATGGTGCAAATGTTCACACATCGACGTCTCCAGCATTGGATATCGAGTTCAAGCTACTTTTCACGTTCGATCCCGGTGATCGACTTTCATC
CACAATGGAAGCTATACTAACAAGTGCATCATCAGAATGCAACGATGCTATTCACGCGCTAAGACCCGAAGGAACACCCCAACTGAGTGAGAAGTCTGAC
TCATTCTCGCCATGTTTGTTCATGCCACCATCACAACTAAAGCGTGATCCAGAACTTACTTCGCTTCTGGACGACACCAGTAAGAGAGCTAGTCCAACCA
AGTCAACGAAGAACCTATCGTCACTCGCGAAGCCAAAGAAGAACAAACTACAGCCCGGAAACCAGAAACGCGATATGTCATCTTCTCCGATACGACTCGC
AGGAGCTTCAATCGTGCGTAACAGTCAGGTACCACGACCATGTCCTGCAGAGGGCAAAATCACTGTTTATCGGCCGGACAAGCTGGATCTGGACCCAGCT
AACGAGAGCCCTACTTTGCGTTCACTGCATCACCCTGAGAGTTCCGACAGAAGGATCAACCAGACAGTGGAAACAGCTTATCACGATATGCAGCCTCGTC
TATTTCGTTGAGTAACTTGTACAAAAGGCTATCGCTGATAGAAAAGATGTCTAACGCTAATAATTCGACTCGTCTAGTGTTGTCAATAGCACAGCAATCA
CACTCCTTGGGGTAGGAGCGACGTGAGTAGCCGCTCCATTTGGCCGAGACTGTCGGCTGACAGACACAATTCCTCACTCTCGGAGTTGCTACAGGTGTCC
TGCAGTAGCTCGAGCATACTCAAATATTCTTGAAATTCTTGAATCGTCCACGAAGGCATGTGAACGCCGTCAGTTTTCACTTCATCTCGAGCTAGTGCAG
AAACACACGTTGGACTCAGTGCGGATCTCCGACTATGGGAACTCGACTGCTTGCAGATAATAGGTGACCGAACATTGACAACGTCATCCTCATGGTCGGC
CAGCTGGAAACAGGGCCGAGCTGCCATGTCAAAAGTGCCCACAGACTCGAAACCGTCGTAGTTGATCATCGGCTCGCAGTCGTCCAAGGAGCCATTGGGT
CCATGTTGGTTGACGCTGTAGTCCCCTTGCTCTTGTTGCGAGAGTTCATCATGATCGACTTCGGGTCCGTCATGTCGCTTCATCCCTTTAACCATCGACG
ACGGTGCAGGAGGAGGCACAACGTCGTTGAGCGACTCTGCAACTGTCGAAAGGTGCTCGCGGGGGTCTTGGGCTGGTGCTTCGAGTTGGTTCATGGCGTC
GTTCACCTCCACGGCAGATAGCAGATTGCAGAGTGCTTCGGGTGGGTGCTTCGCGACAGGACAAGTCGCGCGTGGCGTTCCTCTCTATTTCCGGCCACCT
CTGAGCCGGCACATGATGAGTCGAAGGATAAATGCGGCTCACTTGTCAATCGACGACGTGGTGCAGCTCAAAGATCGTCCGCCACGTACGCCACCGAAAG
CGCGTTCCCCACCGCTTCGTCTGGATATGTCGGCTACTGTGGCCGCTTCAAATATCGCCTTGGCAGCCTCAATGCGCGTGGAGACGAGCACGGACTAAGG
TCGACTGCTGCGTTTAATGCGCTTGCGATGGTGCTTAGCCAACGGCATAGCCAAATGGTATGACCGTTGGCCGGAGTGTGGCGTTTGCGTGTCTGCAGTA
CACGTCGCGGCACGCTTTTAGCTTGGAGTAATGCGTTGAAACGGAGAATTGGCAGTCCCAACTTGAGCTTTCCAACGAGCTGAGTGGCAATTCCTAGACC
TCAGCGTAGGAACTGCCCGGCGTGGTACGCCAAGCTTGACGTCAAGCTATCAAACCGTTACGCGCGTCTTGCGTATGAAGCGACACGTGCTGTGCTACCA
TTTCCAGGGACATGAGGTCTTCGCTGATCGAGTAGTGTGAATCTTCATGCTGCGTGTATCCATCTCGTTCACCCGAGAGCTGTCTGATGCTATCAGCGAT
AGCCCCAGCGTCGATCATGCCGCACGCTACACGGCAGCGACAACAATACGTCCTCTTCATTGGCGACAACAAATGTCCTTTTCATTGAGACTGTTGTTGA
AGTGATCGACAAGTGTCGCTAAAGTTCGAACTCGCCCGGAACGCGTCAATTAAAC