Description :
From Genome Similarity Track
Location :
Scaffold_20:760667- 762842
Sequence
2175 bases(100 bases per row)
AGCAGCTGAGAAGGAGTAGGTGCGCGCCTTGATATCTAGCTGGATGAGCGGTAAGGGAGTGACCGCAATGATACGATGGGTCAGGTGAGGATCGTCGAGC
ACAAGAGCAACAACAAGGACCTGGGGCGACACTTCAGCTCGAGCACTCAGCAGCAGCAAGACGGCCAAGGTGCTGAAGGTGCAGAGTAACTAGTACCAGT
AAACATCAAGCCCTTGATTACTGTAGTATTTATTTATCAACAGTGCTACATACTCCTTCACTTACAGGGCCGTGCTCTGCCCGGAACAGCTCTGGATTTC
ATGTTGCGCTTGGGAATGTAAGTTAATGGCACCTGTACTGCCGCCGCGTAGTGTTTTCACGTAAGATCATACCAGTCACAGAAAGAAGTACAGCTAGAGC
GCAAGAGACGGAATTGAAGCGTAATTATATTTCTTCTGAGTTTTGGTTACCTCGTTCAAGCAGAAAACACTTCGCACTTGTAGGCGCCCCATCGGCGGCG
GTGCCCGAGCCCAAGTTGGCGATGGCTTTAATATTTTCCGACCCGTTCACAATCAGAGTTCGGTAGTAGTCAGAATTTAGGCTAGTAGTGATACAGTTAC
TACTATTGAAGCCAGATTCATAAGCACTCCTACCTTTATTAGTAGTTAAGAAGCAACATTAGTACAAATATTACTACAATTGCGCTACTATAGTACTACT
GCCCCACAATCGGGCGGTTACCGTTTCCTCGTTTGTTTCCTTGATTGCAGGGCAGTATCAGTTGTACTTGGGCTCTAGTCCTTGTTGGGGATGGTTTCAT
CAGTTGAAACTCACGTTCTAGCAGCGCTGCTGAGCAAACACGGCCTGGTGAACTGACCAGTAACAACGAAAATGAGTCCGTTTGCTTCATTGCGAGTGGC
ACACAAACACCATAGTAAGATTTAGCAGTTATGAGCATAATAGTAATTCAAACACGCGCCGTCACCGATCAGTCGTATCACCTGATACTCGCACTTGGCT
CCCTGAATTCACACACAACAGAAAATATGTATGCATACATTACCCTTGTAGATGGATGAACTCTCACACCGAGTCGATCAGGAGCTTGAGGGTAAGTGGG
CTCTGCTCCTTAGGCGAACGATACGACGGGTAGCTGGGAGTCGTTGTCCGTGTAGAAAACCTTGTCGAGGCGCGACCGGCGGGCGAACCTGCCTCTAGAA
TCCCCTGGCGAAGAAACAAGAGTGCGCTCAGATTGGCTGTCATTAAGGGAATATGGCTGATATTAATACATGCAGCCGGCTTGTGCACCATTCAAGCACT
TCATTCTCGACTCTCAAAAACTTGGTACTCTTTGGCGTTGTTCTTACTTGACTTGACTAAACACTTGGGTGCAGAACCACCTTTTGAAGATCCTTGGTGT
GTTGAAGTTTGGAAAAATAGTAGTGATAATAGTAGTGATATTATTACAACGAATGACGTTTTTTTTGCTACTACGGACTGTAGTCTCCAGTATTACCACT
GCTAAGTCGCCCAGATCCTAGGGATATAGCAGGGATATAGTAGTAGTAGTAGTAGTAATATCACTACTTTCCGATAGTATTCAGCAGACAACTACGTACC
GTCGATCACCAAGCTCAACGCGAGAAAGCGGGCCATAGCGCTGCATTTGATTAGATCTCTAACACGCGAATGGAAGGTAGAACTCCTGGTTAGTGTAGTA
ACTAGTAGACATCACTTTACTGTCTGCCTTCATTGTGGGTTCGCCTTGCCGAATCAAAATGAGAAAGTGAGGTATCAACTCACCTACTGGGTGTCATGTT
CGGAAACTCCTTTCATTCATTAAGAAGACGACGGCGTCCAAGATGGCGTCTAAGATGGGGATCACCTTGCCATTCAAGCCCCCGGGCTCTTTCATGGGCA
CCACGCTGCCTTGGCACCGCAGCAGCTCGATGATCTGAAGTGTCCTCTCCAGACGGCCAGAACCAGCGCCGAGTAGCCTTGCTGCAAAAGAGACATCAAG
CGCACGTGCCATGCGTATGAAGCTGCACGCACGTTCGTGAGCAGGCCTCCCGAAAAATCAATTAGTAGATAAATTAATTGACATTTTCACGCAATTATTT
ATTGCAAAGTCTGAGCAGATGCAGCAATTATTACTGCATCAATATTATATTAATGCTTAATTGATGTGATAGTAG