Description :
From Genome Similarity Track
Location :
Scaffold_70:76050- 81056
Transcript NameFunction/comments
Phyta_totarag2857hypothetical protein
Phyta_totarag2858conserved hypothetical protein
Phyta_totarag2859hypothetical protein

Sequence
5006 bases(100 bases per row)
GATAGGATGCCAAGGCGGAATTAGTGCGAGGTCGGACTATCGCCAGTGGTTTGCTTTGCTTCATGACGGCGCCTTCCTTCTACGAGGTGCTGGGCGTGGC
AGCgacctgcagcgccgacgacgtccGCCGCGCCTACCATCAAGCGGCCCGTAAATATCACCCAGACAAGTGCTCGAATGACGTGAGTTCAGACGTCAAT
GACTCAGCAAGTGAGGACGAGCAGCGGTTCCTGCGCGTGCAAGAGGCCTATGAGACGCTACACAACGCGGAGCTGAGGCGGCAGTAcgacgccaagatga
agcaggacgagctggtgcgcAAGAGGGAGCAGGAGGTCGTGGTGGTATCTGACGAGGTCCCGCTGGCCGACATGCAGCGGGAGGTCCTGCAGggagagga
cgacgaggtgatCTACACGCACCAGTGCCGCTGCAGAGACCTGTACGAGATCACagaggacgagctgcaggacggcgtggacgtggtgcCGTGCACGGGT
TGCTCACTGCATATCCGAGTGCTGCGGTAACAGTCCTGGCCCTAGAAGTAAGACGTCGCCAACAAAGGGGAATATAAAACTTTCATTTGCATGCATCCCG
TCTCTCAATACGATGcgcgtgttgctgctctgctgagTCCATAGCCGACGCCTTAGAACTCCTTGCCGCGCGGCGCTCCGTGCGATGGGTATCGTTGCGG
CGTCTGGATCTGGTGGAGCACACCCAGGCCGATGTACGCCATAAAAATGAACAGGAGGCCGAAGAGGAGACCCGCCATGATGTCAGGAGTGATGTTCACA
TAGTGCGAAAAGCAGAAAGCCTTGCCCGCTGCGCTGTATCCAATGAGGTAACCTGCTTCACATAAAATTGCAGCCTGGGCGGAGGAGTTCGTCTTGGCCT
GGGCTTGAGTAGCAAGACGTCGCACAAGCGGGTCCTGAAGCTTCACCGAGTTGGCATCGTTGCCAGTAAAGGCAAAGTCCGTCTTGCCGCCCGTGGCTGC
GTTGAGGTTGCTCGAGGCTGTCTGGATGGTGGCGTCCACTTCGGACAGTGACATCGCCTCTGGCAGCTGCACAACGAGCAAGTCCGTCTTGTCGTTAGAA
AACAGCGTCTGGCCCTCTGCGGACGCGATAAACACATCCAAGTCCAGGGCTCCCACGATGTGAGGCTTGACGTTCGCCATTTCGGGGAGAAGCGGCTTCG
TGCGCGTCGTGTGCGGAATCACCACCGATGACATTGAGCTCTGGACGGCATTCTGCACGAAGGAGTCCCCCGCCCCTCCAGACAGCTTCGCCACGTCCTC
CGAGGCCAGCGACGGCAGGAGGAACAAACACATCACCTCCGCCTGCTGAATTAAAGATACCTGGGTGCTCAGCACACTCTGCAATCGTCGCAATATGCGT
TATCAGTTTAAAAATGACCAGGCCACGTCTAAAGCCAACAGACCGAGCGTACCTCCTTATCAGCGGTCGCATCGCGCGTCAGCACGCGCCCCACAGCCGA
TGCCACCGCTGCCTCGTCCATCTCGAAGCCCAGATAGGCGTTGGATCCAGCGAAGATGCTGAAAAAGGACACGATACAAAACCCGGTGAGACTTCCATCC
ATTACATCAAGACGGAAAGAGACAAAACGCACGGGCGCTGGGACCACATGACGAGTGGCACATGAGGGAACAAGGTGGAGGCCGACACGGCCCACGTCGC
GGTCGCCAGACCGCACAGCGTGgtgctcagcagcgtcttcatcatgGTGTCTTGGTTCGAGGAagcctgctgcttctcctccgcTTTAGATCGCGCTCTG
TCCGTTTCTGTTTTACGACGGCTTAAGGTATCAATGTCGCTTGAAGGTCGCGTGAAATTCGCACAACATTTCCCCTGAAAAAGCCGATTCGTGGCTCACT
CGCAGAAGAAACGCTCAGGTAAGACGACGACAGCCGCCCCTTTGCGTGGAACGTAGCTCGTGGACGTGCTCTGAGGCTGACTGGGTGCCCCCCTAGCATC
TACGTTCGCTGTGCTGACTGCCGCTTTCCTATTCCCTCTGCGCAGTCTATTACCGCCTTTAGCGCAGTTGAACCCCTTTACTTTAAAGACCAAGTAAAAT
GTCGTCTATCCTCGCCTCCCTCGACATGAGTCTGGACGATCTGATTGCCcgcaagaagaccaagaccaCCAACCCGGCCTCGCGTCCGGCCAAGGTTAAC
AAGGAAAAGGATGCGGCTGGCCCCATCCGCAGCGGACGCCGGCGCAACCAAAGCCGCAACCAACCCTACTCGCGATCTGTAAGTGCCACCACGACCTGAA
AGGCAGCTTCTCAGTTTATCCCTCCCCCTCTTTGCTCTCCTACGCTACGGAAGGCAACCCCTCGCTCCCTATCTCTGTGAcggacagacagacagatAAA
CAGACGGACGAGATTCCTCTGTCGTTCTTGGCTCTGGGGGAGCAACGGCGCCTGCCTGTTAGCTGTGAGGACGGACGTTACGTTGGTGCGGAAATTCACA
CGTGCATTgtgtcctgctgcttctccctTGGTGTCCCAAAGCGCGGCggcaatgacgacgacatggacatcgacctggacgacgccCCCGACAGCGGCCA
CTCCCGCGGCGGGAAGAAGCGCTCGGTGGTCATCAAGAAGCCCGGCAAGGGTGGAAAGAAAGGTGCGAGTCGGAACCGCTGCTGCGTTTGTTGCTGAACG
ATTCAAGGCTTTACTGACGAATGGTTGACGATTGTCCTGCCTAACCTTTAGGCGGCTCGTCCATCCTGTCGCGTCTGGGCGGCAAGGATACGGCCAGCCC
CGCCACGAAGATCCTGGTGAAGAACCTCAAGTTCGACATcctggaggaagaggtgcGCGAGCTCTTCGGCACGGTGGGCGAGGTGTCCAAGGCTGAGATC
GTCTACGACCGCTCCGGCCGGTCGAAGGGCATTGCTCGCGTGTGGTTCACCCGCCGCTCGGACGCAGACAAGGCCATCAAGCAATACGACGGTAGGTCTC
ATTTGACGTGCCGTAGGTTACAGTTTGCATCGCCTCTAACGTTCGTTCCTGTACAAACGCCGTAGGACGTACGCTGGATGGCCAGCCGATGCAGATTGCG
CTGGACACTGACAAGAACGTTCGCAACGGACTTTTCGGCACAGCACTTGAGCGTGACAACAAGGACGTCAAGTTTAAGGTGTCTTTCGGGTAAGTCAAAT
ACCCTGAGCTTCGTTTCATTGAGCTGAGACGGCAATGAAATCTGACAAGGTTTCTTGTGCGGTTAACAGAGGAAATAAAGATAACGAGCAGTCAAAGGGC
CGCCGCAACAGACGCCGCGGACGTGATAATGACAAGGGGAATCAGGGGTACGACGCATTGTATTATTGCTGTTGTGAGAACGTTATTCTAAACGGAAGGT
GTATTTCGTTCGTTGTCCTGCAGTGGCCGTGGCAGTGAATTCGCTCCGTCCAAGACTGCTGAAGATCTGGACAACGAGATGGACACGTACATGAAGGACG
CATAAAGAGGATCGTGCAAAGGTGCATCGTGCAGACCGGATGCTTGATGCTCGCCTCGAGTACAAGGAAGTTCTTCCCTGGTAACTATGCATAGTTGTTT
TGCATTTTAACGGGTGCGCGTGGCGAGCGGGTGTTTGTATTTACCACCTTTCGACAGAGCATTTGAAGTGTCGTCGACACGTGGGAGGACGGGCGCGTGA
ATGACTTCATCGCGACACGCGTGCCATATTTGAATAAAGCATCTCCATGAGCCTGAAAAACGGAGTCCCGGCCAAGGTGTGTGCGCTGTATCGCTAACGT
AGTGAACTGCGAATCTGGATGAGGTGTGAATGTAGTGCTCCAGTTAACCTGGTGCGTTCTGGCTTGGACAACCAAGGTCATCTCAAGACTGCCGGTTTTT
GGATGCCGAGGCAAGTCCCTATTAGCACGAACTATTGAAACTCGGGCGTGGGCTGCGAGATTTGAACGCTAAGTTGTGGCTGGATTTGGTGGGCATTGAT
TGTGCCGTTGCTAGGATGTCTGGTTGCTTGTAACTTACATCATGCCGGTGATGATTGCCGTTGCATCATAATATACATTGGGTCACAATAAAGTTGGCGT
CGCGGCAACCATTGCTCACGAAATGGTACGCACAAATGTGGATTGcattggcgacgacgacataGGATGAGAAGTTCACTGTCCTGATTGGTCACAAGAA
CGGATACCCTGACGATGAACATACTGGGGATCGAAACGGAGGAAGAACTGCAAGGGCATCTTCGCGCTAGGCGTGATGACATACATGGCGACGACGTTCA
TCACTGCACCCTACGGTCGCCATGTTCGACCTGGGTGGGGGCCAACGGTGAACACGCAGCTCGGTTGGGTCCTGATGGAGAGCCCGTCGGCTGTCTGGTT
TGGAATCGTGTATTCGTGGGGAGAACACCGCTTCGAGACGACCCCCCTCACTGCAGCGAGTCTGTGGGGATGCCTCTACGTCTACCGATCCTACGGCTAC
CCGTTCCTGATTCGCCCAGGCAAGGACAAACGCATGCCGCTGACCGTGATGCTCTCCGGGGACTTCTACAACATGATCAATGCTTACATCAATGCTCGGT
ACCTGAGCCAATTCGGCGactacagcgacgacgctACATTCGCGCAGCCGTCGTTCTACGTCGGGGTCGCTCTCTTCGTGTTCGGTTTGTCGATGAACAT
CTACTTGGATCAAGTGCTGATCCACCTTCGCAAGCCCGGGGAGAGCGGCTACAAGATCCCTCACGGCGGCCTGTTCGAGTACGTTTCGTCGCCCAACTAC
CTGAGTGAATTGCTGGAGTGGACGGGCtggacgctgctgtctcAATCGCCCGCGGGTCTATCTTTCGTGGTGTACTCTGCAACGAACCTCGTGCTTCGGG
CTCTGAGCAACCACCGTTGGTACCAAGACAAATTCCGCGAGGAATACCCCGCAAACCGCAAAGCCATCCTTCCGTTCTTGTGGTAGACCcaagcacgtcg
tccaca