Description :
From Genome Similarity Track
Location :
Scaffold_557:7605- 9580
Sequence
1975 bases(100 bases per row)
TTGCGGGGTAGAATTCGATTGGGCCTTTCATAAACAGGATGATCCACCAACAGCCCTGCATACTGTTCCAGAGTTTCTTCCTCTCGTTTCGTAGTCGCTT
CAAACGCTAGCGTTTGCCATTCAGTGCACCGCCGTGGACCAATCAATTCATATCCCGGTGATCAAGGTATCATGTCGGATGCGATCCACAAACCTAACGA
AGCTCCATGACCTTGAATTATATCGCTATCGCAGAGGTTTGTCAGCTGTAAATACTTGATCTGGTCGGTCCCACTAGTCACTGTCGGTAACACACGCCAC
AGCTCGCCTCATCCAAAGTTTAGCCCTAGAAGGACCAACCCCGATACGTACTTCCGTCGATTTCCCACCGGAATGACCACGTGTTGATCATTCAGGTTGA
TCGCCTGTATAGTTGATCGATAAGGCGGCTTCCGTCCTGCCAAACCAATTCGCACCTCGTCTGGTAGACACAACGTTCTATCGGCTAATTCCAGACGAAT
GACCGCCGGAACCATAAAATCCATACCCAATATGGCTTCTTGGCCGACTTGATCACCGACACAAATGTCGAAATAATACACCAGCGATCCGTTCAATGTA
ATCTTGATATCATTCGTCTGTCCCACCGCCATATGTTCGTTTTCTTCGATTTCGATGCACTCTTGTGCTTGACTTCCGTCGATCACACATCCTACCTTAC
GAGCAAAGGTAGTATTGAGAATCGACACTTCGACGCCAGAGTCGAACATCATAGTGGCTTTCTCATTGTTGATCTTGCCCGCCGCTTTTGCTTGCTTAAA
CCATTTTCCGGGAGTGTGGTACTTCCAATACCCGCGCAATTCCCCTGCGCGACGTCGATCTCCATCCTCACAGGCGATTGGGAGTAATCCTTCACTCTTT
TCACACTTGATATTGACGAGACTAATTTAAAATCATTATGTATATTAGCAATCGTATCGATCCGATCGGTAATCTCTTGACCCTTCCATTGTCCTTCAAC
ATATGCACAAATGTAAAGCCTGGAACGCTCGGCTCGTGCCAGATTCCAACCTGACGAGCGTCCTTGTTTAACATTTCCTCCAGTTTGGGCCGAAACATTC
CATCATGCATCATGCTTCGTGGGCACGTATCACTTTCGGATCAGATTGAAAAATAATTTCATAGGGCATTTGTCACTCTCATGTACCTCTCCGCATGCTG
CACACACAAAGCAACATTTGTCAGAGGTATGCCCGTTGCGACCACACTTCTGGCACTTCAATCTCTTCCATCACCCTCGATCATCGTGTCTAGTAGATCC
CCAATGGGTATACGCCTTCGATCTTCCACTGCGATCGTGATCATCCGCTCGACCAGTACCCTTCTGCCAGGTGCGGTGATCCTTGTCCGATTTTGCTTGG
TCAAGTGTAGTTGTACGCGAACTCGACGGCGATCCAGGTCCCCATCAGATCCCTTCGACTCCGATTTCAATCCGCTGCTTTCAACTTTCTCGCGGATCGC
TTGTACCGCCCGAGCTGTCTTTGACGAAATCGGATTCGAAGATGCGGTCGTTCGCTGATGGAATTTGTTCAATCCCATCGACGCTTTCATCTGTCAATTC
TCCATCCGCTGGCAGGCACGTAGAGTTTTCTCCATCAATTGCAGTAGGGTCAGCTGTTTTTCCAGATAGCGACCGTCCAACGTAGCAATGAAATGCTCCA
CATATTCGCGACGTGTGGCCGATATAGCCAAGCTTTTGCTTCTCAGATCGCAATCTTGGGCCTGATTTACTGCAACACTAATGCGATGCAGTACTCCAGC
GGTGTTTCATCTGATCGCTTCCGTGCGAGATATATTGTCTGGCCACAGTCACACCTTGCCCTTCATACTGTACGATAAAACAATCCAGCATCGTTTCACT
GTGCCGTGTCGATCGACTCAGTGGTTGTACTAGTTTCGTGCTGGACCTATCACAGATCGTCAAAACCAAACACTT