Description :
From Genome Similarity Track
Location :
Scaffold_1544:7603- 9001
Transcript NameFunction/comments
Phyta_totarag13226hypothetical protein PHYSODRAFT_341850

Sequence
1398 bases(100 bases per row)
CACATCTAACCCTTCACCCGATTTACGGCCTCCTCGTAGATCCATCATACAACTCCCTCACCAAGGTGCGATGGTCACCTTGGTGGTCCGATCCCACTCC
TCTTCGTGAGATTACATCGCTCCAAACCGATTTCGACTCGCACGATCTCGACGGTACTCGTGTAGCAGCGCTCCACAGTTGAGGTCAGTTTCGTCTACCC
AACTGGGATCGTCGTAGCCCTTCCAGTGCACTAGGAACTCTCGATAGGTTCGGCCGTACCGCGTCCGTTTATCAGTCCTCATGTCggtgatcttctccac
ttcgtattCATTCGCACCCAGATCTGGGACCCAGCTATCCTCGGGAAGTAAGATCTCGTCGAAATCTAACCGATCGTATTCGCCTACGGTCAACTCGATG
TGTGGCCGATCCAGGAATTCCCTAACAGGCTTTAACTTCGACACCTGTACAACCGGGAAAATGTGGTACTCGGTCCCATCGGTCTGAAGTCGCATGGTGT
ACTCGTTGATCTTTTCCGCAACGCGAAAAAATACCGTACCACAGATGGGCTAACTTCTGGGCGTAGCCTACCTTCACTCGATCCAAATATAGCCACCTGC
TCCGATCGAGTGCGGTCGAACTCCTTCGTTGTGCCGATGGGATCGATCCGAGATCGCGTTTCGCAGGCGGTCATTAACCTGTTCCCGGGCTTGCGTGAAG
TGTCGTTAGATTTGATATCGCTACCTCCGGGGATCGCGATCCTGTGTTTGAGTGCACCCCAGTGGTATAGTCGCCTCGAGTGTCGATCGCGGATCCCGTC
CGTGCACCAGATAGAAGGGTGTATCTCCACGAACCCTATCTTAAGCTTTGTTGATCGCGAACGTCAGTCGCTCCGCAAACTCATCCCAATCTCGTTGATT
TAGATCCTGAACGAACATCTTCAaagctctcgtcgtcgtctgtaCCATTCGTTCTGCTGTGCCGTTCGACTGAGGTCGGTAGGCCATCGTGGCCCACTGC
CGCTGTCCGATGATCTTATTAAACGCGCGGAAGAAGTCCGACATGAATCCGGGTTCCCGATCGTGTCGAATTGCCTCACTTCCTTCAAATCTCCGGAAGA
CACACGCTTCATAGGATTCGGCGATCGTTTGCGCCGACCGGGACGCGCTAGCTTTGGCGATCACGTACCCCGTGGACAGATCGAcccagatcagcagctc
cgtgttgCCTTTGTATGACTTGACGGTATGTGACCATCGCGATGATTTGGAACGGGTACGTAGCTTGGCTGTTTCCAGGCGATTCGCCCCTGATCATTGG
TCGTCCCTTGCCAGTTTCACAGTCAACACATCCGCCGACATACTTCTGCACGCTATGATATAGACCCCTCCAGTGGAAGTGATCCCGGATCCGCTGAT