Description :
From Genome Similarity Track
Location :
Scaffold_253:7603- 8790
Sequence
1187 bases(100 bases per row)
CTCTTGTTTGGAGAGAATGGTTGCCACCCATCACGTGGATAACCCCGAGGTTGAAATGAAGGACTGCCGTCGCATGCTGTCTGGTgcctgcttctcgctg
ctgtttaGCTGGTTTGCTTCTCTTAGGACAAAGACCAAGACGCAGTACGTTTGGTCAGGCAGTTGTGGACGGGTGCATGAGGTCACGAGAGCTGGCTTCG
ACGGTGTCGGAATTGGTTCGACCAATCAGTTGTGAAAGACGGCTGTGAGAGCGCTCGTTGGGGTCATGGGGTGCCTCATTCCCTGACGATGATTCGAGCC
TGTGCGGGGTCAAGAGCGTCTGACCAACGTGTCATGATGCCGCCATTGTCACGTCGTACGGCGGAAACAACCGAGCAACGTGGGTATGGCGGCTTTAGTG
TAGGACTAAGTCtgcggtggtggcagcaaCTTGCAGAGCGAATGGAGTTTGGACTAACGCGGGAGCTACACGTCATGGCATGGTGTGCGTGGGAATTTTC
TGCCGGGCGTCCATGCCGACGATCGCGATCGGATAGCCGCGCGCATTTGTCATCACGGTGTACCATTGAGCGCCGGCTTGATGGCCGCGTGTCCGGTCAG
GGCAAGTGCGCCTACGTGACGGCCAAGGAAGCGTTGACGCTCGAGTTGAGCCACTCGTTTAACTTCAAGATGGCTCAATGTTTCAGTATTTAATGTCATA
GAACCTTCGGGTCCCGATAGCGCTACATAGATGGATTCTATTCCACTCCATGAAACTAGCCGAGTCACAAGAGAGACGTGGAGTGTGGGTCCTCTTGAGA
AATACCTATCTTGGAAGCAAATCGATCATGCAGCACACtttgctacatgtattataaTATCTAAACTGCAACTAATTATCCAAGGGGTACAGAAGGTCCT
TCGCCGATAGTAGCCTTAATTAAGTCGCGGCCGATGTCAAGTTCTTACGAACGCGGAACCGAACCGGAACCGAACCGCGTGCAGGAGCAGTtatctacat
gtattaaCACGTAGCGGCGATACGGAGACGTTATACAGCCAGCACAGCATCGGATGACGTATGAGCATCGGATGGAGGGCATTGTCTTGGTCGTTAGCTA
GAActaaatgactgtaatgaaaTCCCCATCCCAGACACGTAAGTGGCCCCCAGCATCAGCATCCCAACTCCGCCCAGTATGCTTGTC