Description :
From Genome Similarity Track
Location :
Scaffold_27:760044- 761555
Transcript NameFunction/comments
Physo_133777hypothetical protein

Sequence
1511 bases(100 bases per row)
GGCCTCCTAACTCAGTACGCAGCGGTGGGGCTCATGATGGGGGCTCTACCAAGCGCCACCACGCCGTTCCTCGGCTACTACCTCAACATGGAAGGCCAAG
CCACGACGTCAGCGCGCGCGTTGCTCGCCATCCCGTGGTCCGTCAAGGTTTTCATCGGCATTACGTCGGACTGCTTCCCTATCTGCGGGTTCCGTCGTCG
ACCGTTCATGATCCTGGGCTGGAGTCTGTGCACGATTTGCCTGGTGGCTATGGCGATGCTGCCGCTGGACAGACCGTACTTCCCTGAAGCATCGTGGAGA
ACGCTCGAGCCCAGTCAGTACACGGCCCACGAGATCGCCGCCATCAACTACAACGCGCCAGACACTGGAGGCAAGTACGTCGTGCTCATGATGCTGGCGA
CGCTTGGATACGTCATCGCTGACGTTGCAGCCGACGGCGTCGTCGTTGAATACGCTCAACGAGAGCCTATCGCCATCCGAGGACGCACGCAGACTGCGAT
CTACACGGTTCGCAGCATCTTCAGCATCTTCGGCAGCCTTTTGATCGGATTCGGGCTGAGTTCGCCTCCTTACGGTGGGGATTTCGACTTCGGTATTAGC
TTCCCAGTCTGTGCGATCGTGCTGGCCGTCTTCTGTGTTCCAGTGATCCCCATGACCTGGTACTTCGTCTCGGAGCAGCGAGTAATGGCGCCGAACCCAA
AGGAGTACATGAACGTCATGTGGGAGACAATGCAGAGCCGCGCGGTCTACCAGGTCATCGCCTACAGTTTCTTCTCGGGCGTCTTCGGCGGCATCAGCTA
CGTGGCGTCGGATCCGGTCACGATGTATTGGGCGCGGGCTACGAGCTTCAACATCTCCGTCTCGCAGATCATTGGATCGGGAGTGACGGCTCTCACGCTG
GCGCTGATGGGACGTTATGGTCTGGACTGGGACTGGAGGCGGGTCATTGTCGTCACCACAATTGCAGTAGTTGCGCTGGATTCGGTGTGCACCATGCTCA
CCACGTGGGCGGTTGTACGCAACCAGTGGTTCTGGCTCGGCCTGCCTGTCGTGGAGACCGTCCCAGCGAGCGTCAACTTCATCGTCTCGAGCTTTGTGGT
CGTGGAGCTGGCCGACAAGGGCAACGAAGCTGCTATCTACGGACTGCTGACGACGGTGGGCAACCTCAGCAACCCCTTCTCGGCCACTCTGACCAAGGCC
ATCAACGAGCCCTTTGCCGTGAGCAACCGAGACATCATGAACGACTCGCACACCACACGCCGCGACGTCACAATCACCGTCCTCATTTCGTACACGTGCA
AGCTCCTCTCGCTGGTGTTTCTCGTGTGGCTGCCCCGACAGAAGGCTCAGACGCAAGAGCTGAAGGCTAGTAGCCAACGTAGCAAGGTGCTAGGCGCGGT
TACGATCTCGTACTGCCTGTTCGCGCTGGCGTGGTCGCTGCTCATTAACTTGCTCAGTATGTTTGCGAGCACGAGGTGCTTGAAGATCGTAGGCGGCTGC
TGAGGTGCAAG