Description :
From Genome Similarity Track
Location :
Scaffold_30:76004- 89018
Transcript NameFunction/comments
Physo_134109PREDICTED: similar to chromosome 16 open reading frame 50
Physo_134110hypothetical protein
Physo_134111hypothetical protein
Physo_134112predicted protein
Physo_134113hypothetical protein

Sequence
13014 bases(100 bases per row)
TCCTGGAAAATCTCGGCGATCATGGCTTCACTTCGATCATCAAAAGTCTGCAGGCCCTCAGCATCCAATCCAGTTGGCGGTGGTACTTGGAGACGTCTAA
GAATGCGATGGGGGCGATCCGGGGCCATAGGCACGGTTCTAGCAGCAGCCAGATACTGATCCACCTGCTTCCAGTACGCCTCCATCGTCTTCACGTAGCG
GCGCTTCTCCATTTCAAACGTTCTTGGGGTAGCCTGCACCGGTTCAAGCTGGAGCTGCTTGCTCGTTTTGTTTTCGTTCACGTCCAGAGAAAACTTAGTC
CGCGCCTTGGGGCTCCGGTGGCGAGGTTTCGTAGGAGACGGAGAGCGGAAGATACCCTGACTATTTTCCACATGCCGGGCGTAAGCTCTCGATCCTTCCA
CGTACACACTAAGCTGCTCCCCATCCGTTGTTTCCTCTCGTGGAGAGATAGAGCCGTCCTCTTGCTTCTCACCGAGGGAAAGGGACGATCTATTCGGTGA
TCCCCGCTCGAGCACCGGACACACTGCCATGGGACGCAACGACGGCGATCTCAGTGGCGACTTGGTGAAGGTCACGGGCATGTGTGCCTCCCTCTTTGTG
AAAGTAGAGATCTTCTCGATCGTGAGCGTCCGTGCTGACTGTGTATAGAACGCTCCGATCCGGTCACTCAGGCGATAGTACCCTCGGTCCTCCACACTCG
CCGCCACCTTCTCTCCAGCGCGATAGGACGCGTGTAAGAGCTTCCTCTGCTTGCGAGGGGGCTCCGTCCCTCGTGACAATGGGCCCATGAGTCCTCCCAG
CGGCCCCATCGTCTCCAGCATCTCGTCCTGCGAGCCTTCGAGTCGGTTGATGCGTCTCTCCGACCGCGGGCTCGCGTCTTCGGCCGAGTAGTCCCGGACG
TCGCAGTTGCGCGTGTTGATGGCGCACTGCAGCATCTTGAGTCTCGCCAGGCGCACGGGGCTGCGTTTGGGCGAGCCGCGCGCCACATACGGCGACGTGG
CGTCGTCCCAGACCTTCGGCTGGCCCTTCATGGCCACCTGCAGAGCTCTCGATCTTGACCAAGGCACGACCAGCCGCACCCCGTTTTACCCCGGCCTAAC
GAAAAGCGGTTTAGTGTGTGAAGGGGTGCCAGCCCCAACAGACGCCTATGATCGATGGCATCTCATTTCGCTCTCTCCAGTATTTGTAGTGCATGCGGAG
GAGTCCTCTCTGTGTATCCGGTATCCGGCAGATAGAATATCCTCGCGATCCGGCTCGGCAAGGACAGCGTTGTTGCCATCATGCATATTGGCCTGAACTT
GTTGTGGCTCTATGACGGAGATACCAAATCGGCTAAGTTTAGATAGCACCGTTAGGAGTCCCACCGACGGTGGCCGAGCCTCCATCGATCCGATCGATTC
GGACACGACCTGCGCACGGGTTGAAGCTGGTGAGCTTCTCGCTTCTTGTGAGCGACAGGGCGAGGCGGTTGCGGGATTTTGGGGACGCCCAGCGCCTGCA
GCTTCTGCTGGTTCTCCTGGACGCGGCGCTGCCGCTTGGCCTCGTACTCGCCGGATGGGCCTGTACGCCCCCGCGCTCGCGAGCACTGCAAGAACGGCGT
TACTGTCCATCCCGAACATCTTGGGGGAGCCGCTGAGGCGTGGGGACGCTCCATTGCCGCTCGTTGCTTGCGGGATGGAGATGGCGGGTGGGGCTTGCGG
TGGCGAAGGAGGTCGAGCTTCGACTGAACTCCGGCTAGGGGGGTGGAGCGCGGGGAAGCGGGTTGGAGCGCCGTCACGAGGGCCCTGCGGCCAGCGTCGC
CGAGACGGGCTCGAGGTGACGCATCTCCGGAGGATGGCGCATGGGGAGCTGGCATCGCTCCCCCTGCCGGGGAAGTTTGGCGAATGGCGCCACTAGACCA
TGAAATCTGAGAGCATTTTGTTGCCGCACCGCCAGCGTCGCCAGATATCCTGCTCCTGTTTGACAAGTTGAAGCGCGCCGCAACGGCCAGCGACTGGCGT
CCTCTATGCGTCGCAGTGGACAACGGCGCCCGCGACTGACGACGGTACGCGCCCGGATTTCCGGCCTTTGCCACGGCCCGTGGCACGGGCACACCGCCGG
CTCGGCAGTAAAGGTCGGAAATTTCTTGCTTGGGTTTCGAGCAGTACCGTGGACCGCGGTGGACGCGCAGTACCGTGGCGGCTGTTTTACTAAAAAGGTC
GGAAATTTGTACGGTACTCACTTATCTATGATTTTGTATGGTAAAAGCAATACTAAATGAAATGGAACGAAATAGAACAAAATAATAAATGAAATGAAAA
CACGATTAGAAATTTGGAATTTTCAGAATCGATCACCGAAAGTCGTACCAGATGGGGACACAGTTCTAATCCGTATGTAATTTATCCGTAATTTATCGTA
CATCTGTAAATTACGGTACATCCGTATCGTATCACCGTAATTTATTGTACAGTATGGTTGTTGGAAAAGCGCAGAGAATTGCCAAGAACTCGTTGCCGGC
GGGGGCGATCGGTGCCAGGCTCGACCACCACTGACACAACTCCATTTACAGACTCCTCGAAGTCGAGGAAAAGTATCCCCGCCAAAAGCTGCGACTTGAG
CGAGCCGCGTCCGTTCGTTCATCCGTCAGCCCGCGACCTCTGCGATCCGTAGCGCTTCGACGACTCGAGGAAGGCAGTCATGGTGCTGGACATGAAGGCC
GATGCCAAGGACGCCAACCTGGACGGCCACACTGCTGACAACAACTTCGATGAGCGTCAAGACGTCGTGACCCAGTCCGACGAGGATGCCGCGATCGCCG
CGCGGCAGTTCACTATGACAGGCGTGGTCAGCACGAAGCAGCGGCGGCTGGTGGACGACACCGTCGAGTCAATAGAGATACCGTCGTACACGAGCAACAC
GCCGAAGGAGCAGCTCTGTCTCGAATATATCGCAGGTTTCCAGCGCCAGTTCGAGCGCATGTTCCCCAAGCGACGGCCACTGTATCTACATCCACCGAAC
GAAAAGGGTGTGCCCAAGTTCGTGTGCACCACGATCCGACCGACGCTCCTTCCTTATCGAGATCTGTACGACTGCCATGCGTTGGCCCAATTCTTGGCGG
GTGTTGTCGAGTACGAGCCCCTTGCAAACCCGACGATCCCACCAGTGTGTCTTCCATCACCGACTTTCACGCTCAAGTGGAGGTCTGCAGACAGCTTCGA
CTTGGCCACGCTCTTGGCCTCCTTCCTCATCGGTGCAGGGTACGACGCCTACGTTGTCAACGGCATTGCTCCTCGGTGGCTATGTCTTCTGGATCAGAGC
AAGGCCCCACTACCAGTGTTACCGGTGGAGGAGGAATTGAGGAAGGCGCATGAGCACGACACGACGTCGGATCCGTCCAAAGCGCATGGCGGAGCCAGTG
ATAGCAAGTTGGTGAGTGATGTGAAATTGGTCAGTCGCACAAGCTTCACGAGCAAGTACTTGGAGAGGCAGGAGCTGGCTGAGAAGGAACGACTAGAGAA
GTCTCGTCGAGTCTTAGACTTCAGCTACGGAGAGAATGACGATGACGAGGATCCATTAGAAGGCAAACGGGCACACGCGTGGATTCTCATTCGCGCAGGT
AAGCGCGAGGTTTCGGACCATTTCTTCTTGGAACCCTCGACTGGACGAAGCTACTCGCTGCGAGACTCCCCTTACACGGCCATCGAGAGCGTGTGGAATC
ATGAAAATTACTGGGTGAACATGCAACAACACCCCGTGCACCTTACTCTTTTCGACTTGGCCAACCCAACCGACTGGGAGTACGTCTTCCTGTCCGCGGC
AGAGCGCAAGTCGTCAAAAGAATCCGAGCAAGGCGCTAAAGGTGTGGATCTGTCGGACGATCTCAAGATGCTCAGCACGGAAAGCGACAACCAGCACGGA
GCGGATGCCGCCGACGACGACGACCTTATTCTCGACATTCCTCCGTCTTGGGTGACTAAACTTCACATTGACCGGGCAACCTACAAGAAGAGGTTTGTGA
AAGATTGCCAGCATGTCACGCTGTATCATCGCGCCAAAGTGGAGGAGTTCGCTGACAATACGCACGAGCAGGGCTTGGTCGCACGCGTTACGATCTTCCG
CGACGTCGGGTGTACGCTACCCATCGAGATTCGAGAATACTTCAAGAACCGGAAGGACAGGCTTGAATCTCGTACGCGTTTCCCGTTCGAGGGTAAATTC
GAGGAACGCTTTGCGCCGGGTCGGATCCCGGAAGCACTCAAGTCACGCACCGAGTGGATCGGCTATCGTCGGGAGCTTCAGTTCTACACGAGTGCTCGCC
CTGACGGGCTGGTAAGGCGTGAAGAGGAGATCCAAAAGCGCGTTGTGGAGCATTTCGACGGCCGCGACGACTTCCTCATCTTCCGGTCCGTGACGCTTGC
CACCGACAAGGACGAAGTAGACTCGAAGAACCCCTACATTTTGCCTGGTGGTCCTGCTGGCGAGATCTCAATCAAGAAGATGAAGGAGAAGTTTGCGCGA
AATACTGCCGTTGTAGCTGACGAAGATCAGCGCAAGCGAGCTTACAACCTTCATGAAGGCTCCATCCGCGTGTACTACCACTACGCGACTGGAAAGATTA
CCGCTGGATCGCGTGTCTATTTCAAGGCCCCGAACGTCCCTGTCGAAGTCGTAATGGCGGATCCGAACGCGAAGAAGCCGAAGCTTTCGGTGTTGGAAAA
CGAATTGCGCGCTTCTCTGCAGGTGTACTTGCGGGCTTAACTTCGTATTTGGACGAATTGCTCGTTTGTTCACGATTTTTATGCGTTTTTGTTGCTCAGA
TGGAGAAGGATTGCTACAGCGCGGTGCGGCACTCGGACATTGAGACGCAGGACATCCTAAAGATCCGAAAACGTGAAGAGATGGCGATCGTCTTAGAAAC
GAGCTTCTTCGACACCAACGAGGACGAAGCTCAAGCCAAAGAGAAGGAGGACGCCAAGGAACTCGAGAAAAACGTACGTTGTCTGCAAGTGCTGCTTTGG
TCCACCATTCTACATTTACTTTGTTCACCACCTCACATGTATCACTGCATGACAGGCGAAGAGCGAGGTGGATTACCTCAGCCCATTCTTGCAGAGCGTG
CACGCAACCGGGGATCTCTCCAAGGAGGACGCCCAGACTGTGCGCGATATGTGTCTGCGCAACCTGAAGGAGCGTCTGCTCGAGCGCGCCAACATCATCC
AAGGCCGGCTTGACAAGGAGAACGCGCTGCTGGCCAAGCGCCAGGCCGCGTTCCAGCGCAGTCAGCGCGAGCACGACCAGGGCACGGACGAGGAGTTCGA
GCGCTTCTGCAGCGAGACCATGTTCCGCATCCAGATCCTGGAGCAGCGTCTGGCAAGTCACGAGGAGACGGCGCTGCAGAAGTACGCTGAGATGGACAAG
CGTCTGCACAGCGACCCTCGACTGCGAGTGTTGCACCGATGAACGTGTACTGTACTCTACGCCGCGGTAGACGATGAAGCAAAGGCGAACCCTGTGTGTT
GTAGTTCCTTGTGGAAGCCCTTCGTTTTATTCGCGTTACATGGGAGGCAGCGAGGCATGGAAGTCAATACACTATAAAGAGACCTAACAGAATCTTCCCA
CGCTGTCGCTGTTGCTCTCATGCAGCCGCGAATGCCGCGACCCGACTCACAATTCCCCGACGAAAGCGCGAAAACAAGATGGAGCTGCATAACGCCGCAC
TGACGCCAACGTGATACGCTCCTCTGATTCGACGCTTTATTCAGCAGCTCCGAACGGCCCGCACACTTGATAACCTAAGCAGCGAGTCGGCCTGGAGGCA
GCAGCGGTGCGAGAGAGAGGGACGACGCTTAGTAGTCCTCGTCTCCGCCGAACATGTCCATGCCGCCGCCCATGTCGACCTCCTCTTCCTCCTCAACGGC
CTTCTCCTCCACCTTGGCGGTGGTCTCACCGGCAGCGGCAGCGCCGGCAGCGGGGGCAGCGCCTGTAGAGCACAATATCGATAGCATTAGCGTTGCAATC
CTCCCATAACTGCTATGTAGCACATTGCATTGGCGTGGTCGTACCAGCCGAGGGGCCAGCCAGGAACTTCTCGACGTCCAGGCCGCGGGCCAGCAGGTCG
GCGAAGAGCGGGGCCACGTAGGCGGCCACGTCGTTGCCCGAGGCCTCGAAGGCCTTGGTCAGGGCGTCAGCCGTGACCTCGACGCCGGCGTCGAAGAGAG
CCAGGACGGCCAGGGAGGCGGCGAACTCGTCGCGCTGGGTCTTGCTGAGGTCGGCGAAGGACATGGTTGCGTCAGGAAAGATAGAACTGAATCGGTTTAA
GCTCGCTAGCGGAAGTCAGTCTGCCACCCGATTCGCCGCCCGGAGCGGCACATTTGCCGCGAATGACTGGTCCTGCTAGGGCGGCGGCATTTCTGCCACT
CAGAGCGCGCGCTGTCGGTGTGTTGCGCGAGGTGTGCGCCACACCATATGAGCCGGCGGATGTTGCGCGAGGACGGTCTTCGCGCAACATGCTAGACCAC
TTCAGCCAAACCGTCCACCGCAAGTGGACACTTTTTTTGCAGATTAATTTTGAATGCGGCTTCGGTGGGTAGACGACACCAGTGCACTTACAGACTCTGT
GTGCTTAGTAGGCACTGCTTACCGTTGCCAATGGAGCATTGGTCTACTTCATCTAAGGCTGACAGAGCTCCTACATGTCCCTGACCAACAGAACCGTCAA
GGTCATTCATGCCGGCTGAATTGGCCCAGTATATTCGTCAGGCAGAATTCCCATCTGGACTGCCGCAGCTGTATTCGCCTGCGTATCCCAAGCAGGTGGC
TCTCCCTCGGCCTCTCTTCACCCAGATGGCTGTCTGCTCAGAGATACGCGTCGCAACGGGCAGAGCATTGGACAACACTTGCCTTCTTGCGTCCGTAGCA
GCAACTAAAGCCAACTAACGTACTTCGATGGTGGCCGTGCGGAAGAGCGAAGACGTCACCGTCGTGTTTTCATCGGGTGCTTCGCTGTCTGAGAGCTACC
ACCGCTCTGTTGAAGGCTTCACTCGCTCCGCCCCGAGCACGCCCAGTGGGTGCGGCAGGCGTGTCATCGCCAGCAAGCGTGTGCGAGAGCTCGCCGACAT
CCCGCGTGCTGCTGGACTACGAGATGTGAACGTTGAAGTGACGGTGGCTCACACGAAGAGCAAACTCAAGGCGCGATTCTTCGTGGAGATGAAGCGTGAC
AAGACCATGCTGAGGCAGAGCTGGGGATTCGGAGTGGCGCTGGCGGACGTCCGCCAGTTCGAGGTGCAGATGCGGCAAATTGTGAAGAAGCACTATCGCG
CCAACCGCCAAGGCGAGCGCAATGGGGTCAAGAAGTGCTGCGCCATGTGCATCCAGCTAAAGGAGGAGATGAACGCATGGTCGGCAGTAAATCGCTGGAG
TGCCATCAGTCCGGCTCACAAGGAGCGCAAGTGCGATACCGTCAAAAACTTCTTCGAGAAACTCTTCGCCATGCTGGGCAAGCACGCGCAGTGGATGCAC
GAATGTGAATCTCTGCGCGAGATTCTCCGCGCGGCGGAGGGGCTGAGCGAGATGCAATACCCGCACGATGCTGACGCGGTCGATGTTATCCGTTCACTGC
GTCGCGTTGACATGAGTGACGGACAACAAGACACGGACTGTACGATCTGCATGTCCAAGATCGACAGTCTCCCGGTTGAATCGGCGGAACACGGACGCGC
GTGCGGAGTGGAGCTACCCTGCGGGCATCGCTTCCATGATACGTGCATCTGCATGTGGCTTCACACTCGTTTAGACTGCCCTGTGTGTCGAGGACACATA
TCGGCTCCTGCTAACCCCGCTCTCTCCTCATCGAAGCGGGTATTGTAAGCCACGAATAATGATTAAAGACACAAATATCTACGTGTAGTTCTTGTCTCCT
TGGTTTAAAGTGAAATCGAACGCTATCGCTGTGAATGCAACTAAGCCGATGTGACGGTCCTAGTTTCATCAGCCATAGTGCAGCGGACCATTACACGTGC
GCTCTCAGAATCGCCTTCTCGCCAGCAACCTCGACCCGGAACGTCAGCTGTTCGTGCACGCCATTCGTGATGATGATATCGTACGACCCAGGAAAGCTCA
CAAGGTTCCCCTCCTCGTCCACGAGCGCAAGCGTGCTCCGTTGCACCTCGAAGCTCAGCCGAGTACTCTCGGAAGGTTTCAACGTCACACGACGGTAGTC
AAACAACTGCTTGTTTAGCAGCGTGGCTGGCCCTGATGCATCGGTCTTGATCGGTCTGAAGTAGGCAAACACAACCTCGTCACCCAAGACGGAGCCAGCA
ACACCGAGATCGTAGTGTTCATCGTCGCCGACACCGATTTGGCCGTGGTGGCAGTGGCATCATCGGCCTTCAGCGAAAACGAAGTGTAGCTGAGACCCCA
ACCGAACGGGAACACAGGTTCTCCCTTGAAGTACCGATACGAACGACCAGGGTACGCCGTCACGTTCATACTCTTCATGTCAACGGTATTGACGTAGTCT
GAGCGATACATGGTGACTGGAAGTTTACCACCCGGGTTCGCATCGCCAAAGAGAATATCCGTCATCGCCTGCGCCCCGAAAAAACCTGGGTAGAATGCTT
CCACGAGGGCATCCGTCTGCCCGATGATATCCTCAGCCGTCAACACGCCTCCGTTCATCAGCACCACGACTGTGGGTTTGCCCACAGCTCGAACGCGTTG
CAGCAGCTGCACCTGGATAGCTGGTAGGTCGATGTTGTTACGGTCTCGGACTTCGGCTTCGACGGATTTGTCGATACCAAGGAAGAGAACAACAGCTTCA
GCTCCTTGAACGGCCTTCACAGCCTCGACGAACCCAGCCGTAGAGTTACCAGTAACATTGCAACCCAGTGCATACGTCGTGCTTGAATCTCCGTTCGAAG
CACTCACAGCCTCAAACGGGGTCTTGATGCACCCCACTTCGTTGTAATCGCCATGACACATCTGGCCGAGATAGTTACCGAGCAAGGCGCGTTTGGCCTG
GGCGTGAGGCCCCACAACTGCCAACTTGACCCCTCTACGCAGCGGTAACACTGGCTGGTTGTTCTGGAGCAGGACGATGGACTTCCGAGCGAGATCGAGG
CTCAGCTTCTTGGCCGCGTCCGTGTTCACATCATTCGGCGTCACCTTCCAGTACGGTTGGTCCTCGATAGGGTCAAAGAGACCGAGTTCAAAACGCAGCT
TCAGCGTGTGGCGCAGAACGTCGTCCACTACCTTCACATCGAGCTGATTGCTCTCCACCAGCTCTTTCAGACACGCCATATATCCAAATCCCCTACCGCT
GTTGACATCAGTACCGGCGAGGATCGCCAGCCGTGCAGCCTCACAGCGTGTAGGAACGTAGTGGAGCCAGTCGGAGATAGCTTCGATAGCCCCCGAGTCA
CTCGTGATGTAGCCGTCAAAACCCAACATACCCCGCAGCAGCTTGTTCTCGAGTTCGTTGTTGGCGCATGCCGGAACACCGTTCACGCTGTTGTACGAGC
ACATGACGCCCTTCGCGTTCCCATCGACGATGGATGAACGAAAGGCAGGGAAGTACGTGTCTGCGAAATCGTACGGTGACACAATTGCATTGAACGTCTT
GCGGTTGCCACCCCCGTAGTTTTCGTACGAATAAGCGACGTAGTGCTTGAGGGTAACCACAGCTTGAAGATACCTCGGGTCTTCGTGCTTGCCCTCTTGA
AGGCCCTTGGTATACGCCACGCCGTACTTGCTGTTCACGAGTGGGTCTTCCGACGGCGTCTCTGTGTTGCGTCCCCAACGCGGGTCACGGCTGATATTAA
TGTTGGGTGATCAGCAGTCCAAGCCAAGGTGCGGCCCCGTCGCGTAGTTCTCTCTTGCTCCCTCGAGCCACAGTCCGCGAAGTTCCCAGCCCACAGTCTG
CGCCATATCACGCACCGCCTGTGGATCGAAAGGTTCACCGGATTGGGGAATGACGTCGGGCAATTGGTGCCGCACGTCGACCGGACACCGTGCACGCAGT
TGGCACCCCAGTTGTATTCCGGTAGTCCGATACTGCTCATGTTGCCGCGGGGACTAGCGCGAGCGGTCAGTAGGATGGCCTTCTCGTCCAGCGGAAGGCG
CGCCAAAAGGTCTTCGACACGCGCTGAGACTGGTAACGAGGTGTTGCAGAATTGCAGCTTCTGATGCTCGCCGACACAGGCCCGTGGAATTTCAGCATCG
ACCGATGCAGCAACAACGCTTGCGACGAGGAGCAAGAGGGGTAGCACCATGTTGTGCAAGTTGGGAGTATCGATGTTGTTATTTTTTTTCTTCTTTCTTG
AATCTGCTTGAGTGGATGGCAGAAAAATGCGGAATGGCCGTTGACTTTCGTTTCTGCGGCGCGGATGGCGGTGCTCTCGAGTATCATCCCAAGATCGATT
CCACCCGGAGGTTGCTCTTGGGGATAGGATGAGACAGGCTTGACTTCAAGGCTTGAATTTGAGGTGTCCAAGTTTACACTGCAAGGATTGGTACAGGCCT
TACTGGCAGCTACGCGACAAGGTAATACGTTACATTCACCTCATCCACTCACCACATTGCTTGCTTACCGGTATACTCATGTGTTGTACATGTATTACGC
GTGGATTGAAGTGCACAAGACCCTCATGATCAAGCATGTTCGTGAGTAACATTCCTTACAGTACATGTATTCGTAATGCGACGTTCTTTTGCTGTGTTGA
CCATCGTTTATCGTTATAACTGGCCACACTATGTTGTCGCTACGTGAGTTGAATGCGCTCGTAAATTAACCAGGGTTCACTACATGTACTGCCCCTTGTA
AGCTTGCTTACGGTATTGTGCCTTTCACTTATTCTGCCGTGATAATTCTGGCATAACTCTAATCCCTTATCGACCTTAATTATGCCCTGAGGTAGCTAAT
TCCCATGTTAATTCCGAGTCGTCCCTCCGTGGTCGAATTAGGAGCGGCGATGGTGAGGCCGAGTTAAGGCGGAATAAGCTAATCCAGCCTGTGTTAGGCG
AAAACAGAGCGATTGGCGGCTTCCTACTGTACCCGCCAATCCATGCCATTCTGCTCGTATCTCCGTCGATTGGCTCTCAAATGCTGATCGCGGGTGTTAG
GGGAAGCGCTCACAATCTTAGGCAGAATTAGCACTAAATAAGCGTTAATCGCCCTTTTATGACTCTAATTCCGCCTGAATTAACAGCTCACCCGCCAAAA
TATGTGAAAGGCACAATAAACTCCGTCGTCAAATCCGTCGACAGATGTGCATATTTGGGATCCATAAGCTTAACCGACTGTATCCCACCCAATGCGCCGA
CTGCACACTATCAACAACCAAAATGGCTACTGTAATGGTCTCAAGTCAACGACTTTGTTTCTGGGTTTCCGAATCCCTTTAACTAAAAATGATAGCGAGA
TATTACCACTCCCAGTCCTCTGCGGAAGGCAAACACAGTTTGTCGTGTTGCAACGATTCCGCAGCGGAGTCGTATGTCGGTACGATACACCCGTAACGTG
ACTCCTTCATGCTGTGTCACTCCAGTATGTGGATAGCATCAGTGTTGTTTCGGAGCTCCGCGAAGTGCAGCGCATTCTCTCCAAACTGCGAGCGCAATCC
GATAAATATTTAACGATTGTGCCGTATTTACTTACTAGAAGCGGCATACACGCACGTACCGAGTTCTTGAGTGTCGTGTCGGCGCCGTGCTTACGCAGAA
AATCAATGGCCTCGGTTTGATTTTTCTTGGCCGCCACAATAAGCGGCGAATAGCCTTGCTCGTCGAGGGCATTGACGTCGGACCCGGCCTCGACAAGGAG
TTGGACTACCTCCAAATTCGGCTTTTCACTATAACACGCATGGTGAAGCGCGACAGAGCCATTCTGGACGCAACAAGAAGGCAGAGACCCAGCTTCAACA
CCAATATGCACAAATAGCTGAGAAAAGCAAAAGCTTACAACGTTCTTGATGGAGTGTTTTGAGCCAGCTTGGAGCAAATGCGATACACACCCTGGACTTC
CTGTCCGAGCAGCGTTGTGCAACGGTGTATTTCCGAACTACAAGGACGAAGGAAGCAAAAATATGGTGAGCAAGTTTAAACAGTGAGCCGAGTGTACTCC
GCCCTTACCTGGTTCTGTAGATTGATGAGGTCAACAGCGTCCTCACTAGAATTCTCGAGGATCTTGTTCAAAACAAGTTGCAGGATATCTGGGTCGCCTT
TGAAAGCAGCCTCATGAAGAGGGCTGTTCCGATCCTGGAGCAGATTCAACATATCAGCTAATGAATGTTGACTCCTTTAGCAAAATGGCCAGCAAGCCTC
GACGGACGGGGGTTTTCAGCACTCCGAGCTCTGCATCAGCTTTGAGTAGGATCTCGACGATCTCGCTGTGGCCGTTTGAAATGGCAGCAATCAGCGGCGT
AGCTCCATACTGCGCGCACAACAAGATAACTTCGTGAGCCGATGATACTCGACGCCTGTTTCCACCACTGCGTACCGACTGCGTGCAGTGCCAGTTGATG
TCCACTTCCGGGTCCAGCACAAGACCCCTGACAGCCTCGACGTCGCCAGTCTCGCTCGCGCGGAACAACTCCTCCGTCTGCTTGGACACCACCCGATTCG
CACTCATCAATTCCACTGCACTGCCGATGCAGCAAAGCAAAAATGCACTGGTGACTCTTGGAAAGAATCCTAGATGAAGAGTCGTTCGCTCGATAGGCTT
GGCCCAACCCCAGGGCACCTTGGTCCCGCAATGAAGAAGTGATAGCATGTTGCTCAATAACACTAATCAAGTGCTAATAACCAACTCGTTGATAGAAAGT
GACCGAGTCATTTTCACACCCTCCGTGGTCATTTCCGAATCCTCGCAGTTCCAAGAAATGCAGATCCAAGCTCTAGCGGCGCTGCTGGCCGTTGCGTTGG
CTCCACGCAGCTCTGCCGCCTGCGACGGCTTCGACCAACTTCGCGCAGCTCTCAATGCCAACAGCAACGGCCTCGCGGACTCGCTGACGGCCTGCGTGGC
TCCGCTGCTGTTCG