Description :
From Genome Similarity Track
Location :
Scaffold_2147:760- 3153
Sequence
2393 bases(100 bases per row)
CGGATTCCTTCTACCCGGTGGTGAAGGAGTATGGAGACGTTGTCTCAAAAGACCCACCGACGGGCCTGCCTCCGGATCGAGGCGTGTGTCATGAGATTGA
CCTGGTTCCTGGAACCAAATACTGCGTAACAAGGCAATAACCTTTTGCCGAGAGAGCAGTGTGACGTCATTGACGCATTCTTCCGTGCGAAGCACGAGGC
AGGGATGGTGCGTGAGAGTAAGTCTTCGCACTCGACACCCACGTTCTGTGTTAGAAAGCCGAACGGCAAGTGGCGCATTGTTCATGCTTTTAACAAGCTA
AATGCGGCCACTATCCCGGCGCAAACGCCGATTCCTCGCAAGGATGTTCTGCAGAACAACATGGTAGGCTGTACGTTGTACAGCGCGCTCGACTTGGTCG
ATAGCTACTACCAATTGCTCATGAGAGCGAGCGACATTCCGCTGACAGCGGTGAGTACTCCGAGCGGTATGCTCTGGGAGTGGCTGGTGATGCCCCAGGG
GCTGTCGAACGCACCAGCAACGTTCAATCGTCTTGGGACGCAGTTGTTTAGGCCCCACCGGGCGTACGCTCAAACGTACTTTGACGATATATTCGTCCAT
AGTCGTGCTGAGCACGGAAAGTCAGACGTGGAAAACCCACATTGACCACTTGCGAGCGGTGCTCGAGTGCATGCGCACTAATAAGTTGTATGCCAACTTG
GATAAGTGCGTCTTTGGCGCGGAGGAAATACCTTTCCTCGGGTGCTTCATTGGGAAGCGAGGCTTAAGGGCAGATCCTGCCAAAGTCAAGGCCATCGTGG
ACTGGCCGGTTCCCAAGAACCAAAAGGACTTACGCAAGTGGCTAGGCTTAGCCAATTACTTGCACAAATACAGCGCGAACTACACGGAGATGGCTCGGCC
ATTATCAAATCTCCTTAAGAAGGACGCACCACGGTGCTGGAACGTCGAGCACGACGGAGCCTTTGAGGCTGAGAAGGAGAGCCTTCTCCAGGCTCCGATC
CTTGCGCTACCGGACCCGGATAGTCCGTTTAGCGTCGTCTGTGACGCCTCCGATTTTGCAATCGGTTGTGCTTTACTACAAGCAGACGCCGAAGGGCGTG
AACGCGTGATCGCGTTTGAGTCTCGCCAGCTCAAAGCTGCAGAGAAGAACTATCTAGTTCATGACAAAGAGTTACTTGCAATGAAGTATGCTCTAGTCAA
ATTCAGGGTACACCTGCTAGGCTCTAAGCCTTTTGTGATATTTACTGATCATGCGTCGTTACGCACTGCGACACAGTCGCCTCATCTCTCTCAGAGAATG
GCATGATGTCTTTCCTTCTTTGGCGAATATAACTTCGAGGTGAAGTACAGGCCGGGGCGGCTTAATGTAGTGGCCGATGCGCTCTCGCGCAGGCCGGACT
ACGAGTTAGCTCATGTCACGACAGTGATGTCGTCAGTGCCTGACTTGATACGCAGAGCGTATGCACAGGACGCCATGTGCGTAGCGCTGCTACGGGCTCT
TGGGAGCGAAGGGTTTAAAGACTCTGACAAGGAGTTGTCTGGGCGCTTACGCGCGAGGCTGCATCGATACTCACTCGGTGGCGGCCTGCTGTACTACAGC
ACCGACTCTGAGGATAACCCTCGTGTAGTCGTTCCTCATGATCAGGATCTAAAGTATCGAATCCTCTATGAGGTTCACGATACGCCCGTGGGCGGGCACT
TAGGTCGGGAGAAGACCTATGGCTCGGTGAGCTCGATGTACTGGTGCCCAAGATGTATAAGTGGGTCGGCACCTATGTACGCACGTGTGAGACGTGTCAA
CGGGACAAAGTCCGCGCCGAGCACGGCAGCGCCATTGGCGAGTTTGCCTGTCCGCAAGGGATGCTGGCAGTCCATGAGTATGGACTTTGTGTATGGCCTT
CCCAAGGATAAGGCGGGAAACACAGGTATAGTGGTCTTTGTAGACCGATTGAGCAAGATGGCTCATTTAGCGGCAGTGCCGGACACCATTGATGGTGAAG
GTACAGCTTTGCTGTTTTTAGACCGAGTCTTTCGCCAACATGGCTTGCCTGAGGCAATTGTCTCGGATCGAGATCCGCGCTTCACCGCGAAGTTCTGGAC
GTCCCTCGTCAGAGTGCTCGGAACTCGTTTGGACATGTCCACGGCGGACCATCCGCAGACCGATGGTCAAACCGAACGCGTGAATCGCGTTGTGGAGGAT
ACCCTCCAAAGCGTATGCGCTGAGGCGCCAAAACGCTGGAGCCAGATGCTCCCACTCGTTGAGTTCGCATTAAATAATGCAGTGCACGCCTCGACAGGCT
ACACTCCGTTCTATGTGAACGGCTTGGTTAACCCTCGCGTCCCACTGACGCCGCCACGCAGTGGCTCAGGGCTTGGTGGGGGAGGGATAGCCG