Description :
From Genome Similarity Track
Location :
Scaffold_644:760- 2506
Transcript NameFunction/comments
Phymu_g11322hypothetical protein

Sequence
1746 bases(100 bases per row)
ATACAGCCTCACGCGAGCCGAGCCAGATTCGCTTGAAAAAGCCTTCGCTCTCGCGCTTCGAGAGGATTAtgtggtgtcgtcgtcgtactcCCGTGCAATG
TCAGCTGCTGATCGAGTTGATGCCCCTGAGCCTATGGAGATTGACGCGATCGAGGCGTCGAATGGTCGCACTTGGTCCAGCACCTCNCACCTCGCCCAAT
GGTATGCTACCGCTGTCGGAAGGTGGGTCACCGCGCGGCGGTATGCCGCGCGCCGGCTCCGGTCGTCGCGAACGTCGAGGTGGTCGACGGTTCTATCCAG
GCCGCTCAGCCAAAAAACGGCCTGGGCCAGTAGGTGCGGGGCGCCCTACTGGCTGGAACGATGGTCCGGGTCCTCCGGTGGCAACCCGGCCCTCTGGCCC
TCCTGTGCTTTATGCACGCTTTAATGCCACCACAACGAGCGGCGACTCGAGATTGATTATCGTCAGTCTTCATGTCGCCGGTGCCCGGCGTCCATTGCGC
GCGCTCCTCGACTCAGGAGCGACGAACAACTTCTTCCGCGCATCGTGCTTGTCTGTACTTCCTGCGAGCATGAACGTTCGGCAGGGCCCGGGCGAGGTGG
AGGTCAAGCTTGCAGACGGCAAAGCTCATCGCGTTGCGCGACGTGAGGTGTCGCTGTCGTATACGTTCGACGGCTTCCGCAGCAACGATGACTTCCTGGT
GATTGAGATGAATTACGCGTTCGACTGCATTCTGGGTATCCCGTGGCTTACACGGTACCAGCCAGAGATCGACTGGCTCGCCCGGTCAGTCAAGCGTCGA
CGCGGCTTCGACGTATGTGAAGTGTTCACGCACCTCTTGGTAGCTCCAAGAGACTGGCCTCACGTTACTGTCGTGGACAAGACGGCGACGACACAAGTTG
TGCACAGAGCGAGCGATGGCCCTCTCTGCATGGCTTGTGCCGTGCTGTTGAATGATGAGGATGTCCAGATGGCATCGCGTGGACGCGATGACGGACGCGT
GGTCGAGCGAGAGGCGCTCCCACGTATAGTGAACAAGTCGACGGTNCGGTCGAGCATGGGTTCCCGTCGCAAACTGAGTCGACGGTCGAGCATGAGTTCC
CGTCGGGTATTGTACCGGCGGTCGAGCGTAAGTCACTCCCGCATCCCGAATTCGTGACAGAGAGCGTGGTGCATCAGCGTCCTACCGGTGTGGTCGAGCG
TGGCCTCCCACACCTAGAGGAGGGTGGATCATCGTCCAGTGAGAGCGACACATCCTCTTCGagcacgcgctcgaagcataagaagaagaaatcacGGAGA
CGTCGCCTAACGCCCCGTCGAGAACCTCCAGCGCCTGAAAATCCACCGACAGAGTCGGTGTGTGCCCTCGAGTACGTCGAAGGGGCTCCTCGACGGTCGC
GCGTCATCGAAGTAGCGAGCCCGCCACGCGACGCAGCGGCCATCACACGTCTTCCTGGCCTCTCTTGGAAGCATTTCTTGCGAGACCTAAAGGCTGGCGA
GATCGAGCAAGTGTGCCTAATCACCGCAGCAGTTCCGGTGGATGAGCTTAACTCGGTGAAGGTAGAGGAAAAGTTGTCGAGACCTAAGAACGCCGAGCCA
AAGTCGGCGCGCGAGGAACGCTTCGCAGCGCAATCCTGGGAAGCGTTGCGGGACTCGGGTAATCCGGTGTACGACACCGCCCGCGAGTTCGCGGACATCT
TCCCCGAAAAGATCCCCGCCGAACTTCCGGCGGACCGGGGTGTGCG