Description :
From Genome Similarity Track
Location :
Scaffold_459:76- 4414
Transcript NameFunction/comments
g14460.t1hypothetical protein

Sequence
4338 bases(100 bases per row)
CCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACC
CTCTCAAATCTGGTCATCATTTTTGACCGGATATTAGGTTTCATAAAACTGTAAAGTTACATACCTGTCAAATCCGATCAATCATATTTGACGGGTTTAC
GTATTTCAATAGTTTTATTTTAGTCATTTTCGACCCTTTCATAATTGTTATAACCGTGGTAACTGATATCATATATAACGGGATATCAATATACACAGGC
GCCCAGGCACTTAGTAATTTGACAGGGATGCAGACCGAATTTCGCAACTTTGAAACCGGCTTTGTATACTAAATCGACTACGCTGAGTTCGATTCCGTTG
AAAAATCAAACTTTCTGAAGCTCAGTTTTGAGATAACAGGTTTTTTGCGTTTAATACAAACTTCCAGTCAACTTTTGAAGTTCAAATTTTGGCTGCAACT
CTAACTCGGTGAGTTACATATGTGTGCAAAGTTTCAGAAAGATCCTGAAGCTAGTTTTTCCAGGGACCCCTCTACTAAACCCTAAACCCTAGAAGTACCG
TATCTTCTCCATAACATAATACCTGTCTAATCCGATTGATCAATTTCACAAGGATATACGTTTTAATATTCATTTTGTCACGTCCAAAAACCTTGTAAAA
CTGATGCCCTGTCAAATCTGTTCATCGTTTTTGACGGGATATCAAGTTTCATAAAACTGTAAAGTAGCATACCTGTCAAATCCGATCAACAGTTTTGCCG
GGTTTATGTATTTCAATAGTTTTAATTTGGTCCATTTTGACCCTTTCATACTTGATATCACCTTGGTAACTGATATCAGCTATATCAGTATATCAATGTC
CACAGGTGCCCAGCCACTTACTAATTTGCCAGGACAAATGTTCATCCGGGCGTTAATTTGCAAGATTGGATCTAAAGATGCTCTTTAATTGTAGGTCAAC
CTCCACCGGGTATCTACGCTAATTTGAACCAATCACAACACTGCAGCCTCCACTGGATTCCGTGTAGCCTCCACCGGATTCCATGTCAAACATGCAGTTT
AAATGTCAGTTGTGCCATTTAACTGTCATTTTGCCTCCACAGCCTCCACCGGATTCCAGTGCAGTGCGCGTATTCTGTATACAGGTTTAGCGGTTTAGCG
GTTTATTAAACCCTAGCGGTCCATGGTAGTACAGTATCATCTCCAAAACCTAATACCTCTGTTATCCGATCAATCATTTGTTACGGGTTATAAGGTTTTA
GGTTTACTTTTTTCATATCTGGCATAATTTTTGAAAACCCAAAATACCTTTTCAAAATCTTCAAAATACCTTAATTTGGGTTCCTGGGGACCCGGATGAA
TGTTCTGGGGACCCGGATGCCTAAAATACTGGGGGTTTTGGGGACCCAGGGGACCCCGGATGAACGTTCATCCGGGCCACAATATATATAGGCGTACTCG
CTGCGCTCGTCTCACGTGGTTCCCGTGTGTACGAACCCTAAGCCCGCTACGGCTCGCAAGCTTCGCCTCCGCTTGTCTACCATGCACTGTTTGGTCCTGG
GTTTTCACCCGCGTGCTTCGCACGCGGACTTCAAACCGCAGGCGTGCTCGCTGCGCTCGAGGGGGAATGGCGACTCTCAACAATTACCGCTATGCAAAGT
GACAAATGTATTCCTTTCGTAAAATATGCATTCACACGAAGTCGCTGCCTACGCCCTCTCGAACAGCTGTCGGTACACTATGTTCGCCGTGTACACTCCG
TCTTCTTCCTCCCGCTCTGGATACTCGACCAATGCCTTGAATCTCGACCTCGACGTAACCCTTGATATGGCCACATACAGCTGACCGTGGGAAAAGCAAG
GAGTCGCCAAGTACAGTCCCAGGTACTGCACCGTTTGTCCCTGCGCCTTGTTGATCGTCATGGCAAAGGCATTCTAGATAGAAAACTGCCTGCGTCTCAG
TCAAAATGGGAAATCGCCTATGTCGCCATCGCTGATGAACACGATGCGCGGGATCAACACATGCTGGCCTTGCCTGTCGCCGGCCATGATGGTGGCATGG
ATGACATGATCTTTGAGTTCGACGATTCGCAGGCGTGTTCCGTTGCACAACCCCATGTCGGGATTTAAGTTCCGCATCATGATGATCGACATCCCCTTTT
TGAGTTTCAGCTTGTGGGGTGGGATGCCACTGATGTTCAGGGAGTTGAGCACCTCCTGCTCGAATAAGTTCCCGTCCTCGTCATCCTCCACTGAGTCTGT
GGACACATATTCTCGAGCTGGTCCAGTCATGCGATCCGCTACGGCTTCGTTGATACGATGTACTATCGCGTTCGTGGTGGTGAGGATGGTGCGACTCGCA
AAGTACTCGTCCGTTGCGACTTCCGAATTGTTGATGTCGGCGTACATCTCGTCGATCATGCGCCGCATACCTCGCGGAATAGCTCCCGGTCGGATCTCCT
CGTCCTCATCTGGATCACCGGCGGGGTTGTCGATGAGCATGTCGCGTGGAATCTTAATGTAGTCATTTCCCAGATCGTTGTGTACCTCGTGTCTCCCCTC
TCCAACCTCCAGCAGGTACTCGGAAAACGCAGCCATTTCTGCAGCACTATCGGACGTGGCAGCCGTGCGAACACGCATGTTCTCTGTCAGACGCACCTTA
AGGAAAAGTGGCCACAGTTCGGATGACTTCAGGCATGCGTCGATTGTCTCTGTAGCCGAGCCGCCCTTCACCACGGGGAGAATTTGCCTGAAATCTCCCG
AAAGCACAACGACTTTCCCACCGAAAGGTTCTGCCTCGTTATCCAAAACGTCACGAAGCGTTCTGTCCACTGCCTCAAACGCGTGCCGATGCGCCATGGG
TGCCTCGTCCCAAACTATCAAACTTGCTTTCCTCATCAATTCAGTGACCTGGGATCGCTTGTTGATGTTGCAAGTAGATTCGCCGTCTATCTTCAAGGGG
ATTTTGAAGGTAGAATGCGCTGTCCGACCTCCCATAAGCAGCAGAGAAGCAATCCCACTGGAAGCGACCGCGATTGCAATTTTTCCGGATAGACGAACCT
TGGCCAGTATGTTCCGAAGCAGTGTCGACTTCCCGGTACCGCCTGGTCCATCAACGAAGAATAGCTTCCTGCCTTCCTGTGGGTCCTCGACAGCTTGGGT
GATCTGATCATAGGTGAAGCGCTGCTCCTCATTTAGGTGGTCCTCCTCGCTCACAATTTGTTCAAGAACAGACGCGTCATATCCCGTTAGCTCTCGTCGG
ATGAGATTGTTTTGCAGAACAGACTCAAGCACCAGGCGAGGGAACTCGCTCAGCCGAGGGAGATCAAAGTCTTGGACGGAGTACCCACTGACACTGAGCA
AGTCTTGGATACTCTTCAGTGTGTCGAACGTCACAACAGACGTTTTAAAAGGGTCCAACATCTCTCGGTTCCTGTACGCATAGTCAAGCGAAAGGTCTTT
GAAGAATTGGTCCCAAAGACCCCGAACATCCGTAGGCGCCGAGTAGACCAAGATTGTTGCAAAGAGCTGGCGCAGCTGGTACGGCATCTGGAACTCGGCA
GCCTCCGACAAACACAAAACCCATTCGCTGTCGTTCTCCAGATAGCCGGCATGTTCAGCCGCGTCTCGATACGTGGGACACAGCACACCATCAACTGTCC
GCAGGTCTTCGAAAGACCTCGGTCCTCGGCGATGGCATAATAGCAGGCGTAAATAGAAGCGCTCCATATCACGCGGTGAAACATGCACCATCCGACCAAT
TGCAGCCTGGTACCTTTTACGTCGAACCCAGCACTTCGTGTTTCCCATCCAGCGAAATTCCTTGGGTATATCCTGGTACAGCATTGTCTTCGCGATCTGG
TTCTCGGGTTCGTCGCTCGCACACAATTCGAAGAAGCGGGTCAACATGGTGTGATTCCCACGACCAAGGACACGCTCCGGGTCTTCCGTCGCTCTGAAGA
ACACGGTTTGGGCATCTTCGACGTGAACGGTAAGCTGAGTGACTGCGTGTGTCTTTCCTTGGATCAAGAAGTCGAGTAAGCGGATACAGGCTTCAACTGG
AGATATGTACCTGGCCGTGAGGAAGCGCAGAATCTCGTTTGGCTCTTGCCGAGGGAGCTCTCCACCCGCGCGAACTGCCTCGACAGTTAGCACATCTTTA
TCGGACCCTTTGTAGACGTACTTGTATAGATATTTCACAGCTGAAATATCCGTGCACACCTCGACGTTGATGTGGCAATTGTACTTTTGGGATAAGTACG
GGTTGTACGGAACAACCCACTGGTTAATAGTGGCGTTG