Description :
From Genome Similarity Track
Location :
Scaffold_1274:76- 3024
Sequence
2948 bases(100 bases per row)
CTTCTCCATCAGCTGGCGTAAACCATTCTTCCGGTCTGCGTTGCTTCCAATAGCCCCGCGTTTCTCCAGACTGGAGATCCAAAGGCACTTCGGCGTCAGA
ACGGCTGAAGTCGTCCGATCGATGTAGACTTAAGACCTTGGCGGTAGATTTCGCATGCAGATCACATGTATTACCGCGTAGATCAGTCCGTCCACTTACT
CGATCTACCGTGTTCTTGTTCACGAATGCATAGATGCAGTACCTAGAACGCTCGGCTCGTACCGGATTCCAACCCGGCGAGCGTCCTAGTTTAACATCTT
CTCGGCGATCGCGGGCAACATGCCAGCGTGCTTCACCGGGTTGAACCATTGACGGATCTGGTTGTAGAATTCCTCCATCGGACACTTGCCCATCTCGTGT
AGTTCACCACATCCACGGCACACAAACAGGCAGCGATCCGCCGGATGACCTCTCTTGCCGCACTTCTCGCACGTCAAACGTCTCCAACAATCGAGATCGG
TGTGTTTCCGCGATCCACAATGTGAGCAGCGGTTTGATCGCTCCGATCCGTCAGGTGAAGATCGCGATCGTGGATCCGATCGAGGTGGGTCATGGTTGAT
CTGCGCCTGGTTGATTCGATCCGGCTTCGTCGCGTCGCCCCCAGCGTTACGGGACTTGTCCTCGGTCGACGCTAGGTAAACGCGACGTAGATCACNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNGCTCCACTTGATCCGCGTCGATCGGCCCAGCTGGTGGTACCAGTTCTTCGCCGGGCCCGTCAGTAGATCAGC
AAAGGTCAGGCACTTCTCTTCGTCCGTAGTCTGATTTCGCAGGAACGCCGACTTTACCTTGCTGATCCACGATCGGCCGCGGTCTTCGTCCTGATCCTTG
CCATTGAACTCCTTAAGATCGGACATCGCCGAAATCCGCCCACGCTGGATCAATGAGGACCCAGTGGATCCTGAGGCAGCGGTGGCCACCGCAGCAGGGG
CTGAACTCGGTAGATCAATGTCGTCCGGATTGTATTCCTACTGAGAGAGATCTTGATCCAGCGATCCGGCTGATTCCATCTCCACGTCCCGCGAAGACTC
CAGTTTGCCAGTCGACTCATCTGATCCGGTAGTACTGGTGGTCCGATCGGTCGACTTGGGTTTCTGCTTCCGAGGTCCTGATCGCATGCGTTCCTGACGT
TGACTCCGTCATCGTGCGTCCAACATCGCAGATCCTGAAGGGCCGAGGGACATCCGTTGAGGTTCAGACGACGTATCCGATACGTATTCCGCTGCGGAGA
CATAAGGAGACGACGATCGGTACCCAGTGGACTCCATCCGCGGCGACGACGCGGGAGCTGGCGACACTAGATCTGGCACCTTCGGGTCCGGACTGTCCGC
GATCACGTCGACCAAAGGTCTCAACTTGTCGACCAATGTCTGGATCGCTGTCTGGATCACATCGAGATCCTGATCGAAAAGATCATTCGCTTCAAAGGCG
CCAGCCACGAAGCCGGCTTCCTTCAACAGTCCGAGCAGGTTCTTCACCGCCATCAGCTTGTTGTCCGCCACTCGGGGGGCCGAGATCGGGCCCTTCGGGT
CGTCGATCTGCTCTGGCCGCAAGATCACCATGACGGGATCTTGACGCAAGAAGTCTCGCAGTTCCTTCAAGTGATACTGACGATCCAGGTCAGCCTCGGA
CCAGTCGAGCGCCGACGGTCTGGGATTTTCGTCGTCCAGGCCTGGCGCTCTCAGCTTCTTCCTCACAATCTGGTCCTTGTCCGCGATCGCGTCCAGGTAG
TCCGGATCGAGCCTGATCGGCGAGTCGGCGAACGCGTATCGGTCTGATCCCGCCTTAGTTTGTTTTGTTAGTGAATCTCGGTTCGCACCAAGATCCACCG
GGGTCCCCGAAGGGACCTGTGGAGGATGTTGAGGTTTGTCTTCTAGATCTGTCTCCAGATCGCCCTCGATTCCGTCGACAGAAGTCCTCCGAGCACTCTG
TCGATCCGCGGATCTCGTTTTGTTCAGCAGCGTCTTCGTTGATCCGATATCCGACGACGCCTCTTCCCCTGGTTCTTTCTTCACTTGCGCATCTTCTACG
GACTCACGGTGAAATCCCTGGTTCGAATCCGGGCACGCACACCATTGTGGTGTAGCGGGATCGGCCAAAATCTGGTTAAGGCCTGATCGAGCTTCCCACC
AGCGCCCAGACACCGACTAACGGAGGGGGGTCCCCCAACGATCCGTGATCGGCTGAACTTGTTCTCACCTTGTGTACCCGTCGGCGGGCTGGATATGCTC
TCTCGGGGCTCCGAAGATGCAGAACTTGGTGAAGATCGAGTGTCTTGGCGTGACGCGGGGATAGTTTGTGGGGCAGCGCGGTAGTCTTCGCTCTGCGTCC
GAGTATACGCTCCGATCGAGGGTTGTTCGCTCCGATCGGTCGGCCTGGAGTTGATCCAAGGCCTGTAGTCGCTTTTCCGGGTGTGTTCCTTCCTTTCCTG
AGTTGCTTGCCGCTTCCTATAGCGGGATCGAGGTTGATCGAGAGGAGA