Description :
From Genome Similarity Track
Location :
Scaffold_1247:76- 2524
Sequence
2448 bases(100 bases per row)
TCACAGACCAGATGTTTCCAGCATCCAGATTCAGTGTGCTTCCAGGATCCGCACTGCGAACACCTGACTTGTGCTGTCCCGTCCATGAGATCTCGGGATC
TGTACATCCCACGGTCCCCGGCTACGGTATCCCCCGGTCGAGAGTTGTCTCCGGTCTTCGCCGTTCGATCGTTGGACGCAGTGATACAGACTCGACGGTA
ATCCTCAGGGTCGGAGTCCGAACCGTCGGATCCTGACTCAGTTCCTGAGTCAGGCGCCGTGACTTGGTGGACACGTCGAGCTGGGGCCGTGGGCGTCGGA
GCCTTTTGGCGATACTTGCCGGATCCGACCGCCGCCTTCTTCTGGCGGTGTTTCGCGCGATCCACAGCCCGCAGCACTTCTTCGAGCTCATCTGCGTCTG
GAAGACGTAACAGGGTCAGCCTGTCGGCCAGATCCACATCTCCCAACGTCTCGATGAAGTGATCCACGTGTTCCCGCAGTACCTTGGATCCCCCATCCTT
GATCTTCAACTTGGCCCGTAGACCGGCCACATTTAGTCGATGTAGGTATTCCAGCGGGGATTCATCCGATCTGCGGCGAGCATGGTAGTATTGTCGTGCC
ACCGACACTCCCAATCCACAGTACTGGGTCTGGAAAGTGCGCAGCAAATCTGGCCACTTGTTCCTGGTGGATCTGCCCAGCTACCGATACCAGCTCCTGG
CTGGCCCCGCTAGCAGATCCGCAAAGGTCAAACACTTCTCAGCATCCGACGCTTGGTCTCTCATGAGGGCCGACTTGACTTTGCTGATCCATGTTCTCGC
TCGGTCCTCATCTTGATCCTTGCCCGTGAACTCCTTCAGGTCCGATATGGCTGAGATCCGTACCCTCTGGATCATGGACGATCCTCCTGCCCCGGCTGTG
GCTGTTGCTACCACTGCTGACGAAGCGGATGGGCCATCCAGATCATCTGGGTCGAACTCATCATGGGAGTTGTCTCCCTCCACTGACTCCATTTCCACGT
CTCGTGCTCCATGTTCGTGGAGCACTTGCACTTGTGGCACGGGCGCTCTCATACCTTGTTCGGCCAGGAAACGACTCATTGCAGCTTCGAAGTGTCGTTG
CAGGGTGCCCGAGGAAGTGTCGGAAGAGCCTGTGGCCGTCTGGGCCACTGGCGAGACAGGATCCGTGAGGCGATTACCTCGAGCCTGATCTGACGATAAT
CCCACTGGCTTCTTGCTGGATCTGGCTCGATCCTGGCTGGATTGTGTCAGATCACGCGTAGGGCCTACTGGATCCCGAGCCTTCACGTTCACAGGGGCTT
CCTGTCCTCGGACCCTCGCCCGCGCTTCCAACATGGATGCCCCGGAGGGTCCTAAAGTCATGCGTCGTGGTTCGGACGACGTGTCTGACTCATCCTCAGC
GGCGGATTCGTAGTTCAAGGACGCAGCTTGGCTGATCCTCGGCGATGACACTGGATCCATAGTGTGCGACCTTTCTCCGGTGATGGACTTAACTCTAGCA
AAGAGGTCCCGCGTCGCGGATGGTATGAGATCCAGATCTAGCTCGAAGATATCCTCTGCGTCGAACACACCAGCTACGATGCCTGACTCTGTAAGCAAAC
GTAATAGATCCTTGACTGCCACCAACTTGTTCGCCGTTTTCGTTGGTGCTCTCACCGGTTCCCTTGGATCTTCGATCTGTCGTGGATTCAGAATCTGTGT
GGTGTAGCGGGATCAGCAAAATCTGCGAGATTGCCAGATCCAACTTACCAACTGCGCCCAGACACCGACTAACGGAGGGGGTCCCCCGATGATCCGTGTT
CTGCTGAACTTTCCTCACCTTGTGTACCCGTCGGTAGGGCGGGATCTGCTCTCTCGGTAACTTCCGAAGAGTTCAAGTGGCGAAGCTTGAGTGTCTTGGC
GAGACGTGGGGATGGGGTGGAGCAGCAGTGGAAAATCTTCACTCTGCGTCCGTGGATGGTTCCGTATCCTAAGCGAATATTCGAGCTTATGGATCCGGGG
CTTAGATCGTGGATCTGGCCGTAGGGTTGCCTTGCGGGTGTGTTCCCTTGCCTTTGTGTTGTCCTTTAAGTCGTACTTGCCGCCTCCTGTGACGGGATCT
TGAAAGTTGAGAGCCTCTAGGGTGTAACCGACCAAGTAGTAAATTCGGTTAACCTGTCGGATCTGCACGAGTAAAGGAAAAGCTCACTAGGTTGTAGGAT
CTAAATATCATAATCGACAGCACTGCCCACAAGAGCTCATTCACAACAATGGCGTATATTTGTGGCTCACGAGCCTTCTCAGTGCTCAATCAATATGACT
CAAGTTCAGTCCTCAAATGATCCATTGATCATATTAGTCCAGCTGGCGCCTTTGGGATTGTCGGACTGGGCATCCCAGAAGTCTCTCGCATGACGAGCTA
CGTTCAAAGGCTCGAGCTGGCAGTAGCGGCCTACCGGTATCACGTGCG