Description :
From Genome Similarity Track
Location :
Scaffold_1625:76- 1131
Sequence
1055 bases(100 bases per row)
TCTTACGATCGTATATCGACGATCTCTACGACTGCGCTGAGGCCCGTCAAGATCAGCTAACCGATTGCAGTGCGATCCACAATCAGTTGAGAGCTCAAAA
AATTCGCGGCGATCGCTTGGAACGCCAACTGCGCGACGTTCAAGAATTCGCAGGACGATCCGGCAATTTGTGAACAAGCAGTACAACAATCTGCATGACT
CGTTGGATGATGCCGAACAGAAAATCGCTGAATTCCAAGAGGAATCGGCTGATCAAGAGGAACGTCTACAACAGATTCCAATCCTGAAGTCTTCCCTCCT
GAAGCTTAAAGCGGACCGCCATGCCAAACAAGAGAAGCATCGGCATCAACTGGCTATACTCCAAAACGAGTTAGAATCAGCGATTGCGTCTTCCAAGGAT
GCCGATGATCAGGCGAAAACTCCAGATCGAAAACGCGAAAACCCGATTTGCCGCCCGCCAGTCCGCGATCATGAGAGAGTTAGCCATGGCCCAGCGAAAC
TTGGGTACAATCAAGACTGAGCGCGATCGCTTCGCAGCTCAGATTTCAGATCTCACGACTCAGCGCGATCGGCTAAACTTGGATCTCGCCGATCGAGATG
CCGACGTGGTCGGTTAGTGAAGAAAATGGGCGAGTTGAAGGTAGAGCGCGATCAGGCACTCCAGTCGAAAGATTCGCTCTTCATTCGCATGGCTGAAGTA
GTCTCCAGTGCCTCTTCAAGTGCTATGCCTGCGCCTGCGACGCCTCCCCGGAAAAATTCCCCGCTTCGTCACAAGCGATCGCCCCCTAACTCGAAGTCCG
GGAAACCGAAAACCAAGCGTGTCCGTCGTACCATATCGTCGCCGGGTCGATCCGCTTCTCCTGATCCGTTTGTTTCTCGATCTCCATCGCCAGAGCGATC
GGAGAGCAGCGATCAAGTGGATTCTTCTGCTGCTGATAACGATGATTCTCTGCTGGCGGCATTATCGTCGTCCCGTTCTGCCGCCCGACGTGGAACTGCA
TCGCCTTCCAAGAAATCATCGCCTGCTCCGAGTTCTCCACCAATCAGCGTTGATT