Description :
From Genome Similarity Track
Location :
Scaffold_363:7599- 11323
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_363-fgenesh-gene-0.2Phosphatidylinositide phosphatase SAC1
Pytir_DAOMBR486maker-pir_contig_363-snap-gene-0.20Dicarboxylate/amino acid:cation

Sequence
3724 bases(100 bases per row)
CACGTTCTACTTCTCATACGACTACGACCTCACCCTTTCGGCGCAGCGACGCGCGAACAATTCAGCGTCGTCGAACAGCCAAAAGCTACCGATGTGGCAG
AAGGCGGAAGAGGATTTCTTTTGGAACAAGCCGCTGCTGACCAAGTTTATCGACATGGACCTGCACAACTGGATCATCCCCGTGATCAGCGGCTTTGTGA
AGGTGATGAAGAAGTGCGAGATCAATGGCATGCGCTGCGATTTGTTGTTTTTCACGCGAAGAAGCTGGCGCCGCGTCGGCACGCGCTTCAACGTGCGCGG
CGTGGACAAGGACGGCTTTGTTGCGAACTTTGCCGAGACCGAGATGGTGCTGGTGAAGCCGAACCGCTCGATCTGCTCGTACGTGCAGATCCGCGGCTCG
ATCCCGCTCTACTGGGACCAGATGGTCACGCTCAAGTACATGCCGCGCACGCGCTACGCTTTCAGCGGCAACGAGAGCATCGTCGACTGGAACGAGCTCG
CCTTCCGCGCGCACATGGACAACATCATCCAGCGCTACGGTCACGTGACGATCGTGAACCTTATCGACAAGACGGGCAAGTCCAAGACTGTGCGCGATCA
GGCGCAACTCGGCACAGCGTATGGTAAGTACGTGAAGAAGTACAACCAGCAATCGCGCTCGTCCGACATGCCTTCGCTTGGGTCCAGCATGATGGCGTCG
CCGCCACTCGGCAACTCGCCCAAGCACCGCCCGACACTGACGGCTGCGTCTACCGCGGCGTTACTGGGTGGTGGCAGCGGCAGTGCGCAGACGTCGCCTT
CGAATGGCTCTCCCTCGTCTACNNNNNNNNNNAGAGTAAGAAGCCGAGAGAGAGGAAGCCAAAGGACAAGAAGAAGAACGCTGAGAGCGCTGCTGCTGCG
GACAAGGAAGATGTGAACGGAAAGCCAAAGGAGGCTGCCAACAACAACAGCAACAACACCAAGAACGGTAAGAAGAGCGAGGCGAATGGCGAGAGCATCA
AGCCAAAGGCAGACGGCAGCAAGAAGAAACAGAAGAAGACCCGCCCGGCAAAGAAGAACACCGAGTGCTTTGACCCGATGACGAAGCCCGTGGACCTCCG
CGTGACCTACGACCTGGGCTCGAAGAACGACAAGTTCTCGACGTCGCTGACCACGCGCGACGTGTTGCTGGTGCCGAACCTGTTTAGTGACTTCAAGAAG
GGCGAGCTGTACGCGAAGCTGGTAGCGGAGATTGAATCGTGCGGCATCCCACCTGAGCATCTGCTCAAGATGTGGCACGGCAACGACAAGATTGACGGCA
CGCACCTGATCGCGGACGACAAGACCCGCTGGAAGAACAACTGCCCGACGTTCGACCTCGTGATCGGCCGCGTAAAGAAGTTCTTCAACATGTCGGTCAA
GGCCACGCGCTTCAACTGGTACAAGGACACGTCGCAGTGGAAGCCGTTCCACTTTGACGCCGCGGCGGTGAAGCCCGAGATCGCGGCGATCCAGAACTTC
ACGGTGGGCATCTCGTTCGGCGCGACCCGCGACGCCGCGTTCGAGCACGCGGACACAAAGACCGTCGTGAGCATCCCGCAGCCGGACGGCTGTCTGTACG
CGTTCGCGAAGGACACGAACATCATCTGGCGCCACGGCATCCTGCAGGACAACCCGGTACGCGATGAAGGCCGCATCTCGGTCATCGCCTGGGGCTGGAT
CGACGGCATGGTTGACACGGAAGAGGTCACTAGTCCATAAAGTAAGAATGCGCGAGTGAATGGATAGGTAGATGGATCAATCGCACCCACTCGGTATGTG
TGAAGAGAACAAGAAGTGCAATAAAGAGAAAGAAATCAGTGTAATGAATGGACAGAATGCGTTGAGAGAAAAAAAGAAGATCGGGGTACTGTCGCTTGTG
TGGTACCCTGCGTCTGTTGTCATTCCAACCGAGACGAAGTCCCTCAGCTTGATGAGGAACACAATATTGCTGCATCCAGAACGAGATGCACCCGGTCAAC
ATGTTTGGTGCTGCGGAGTTTCCATCTGCTCGTTGCCACTGAATACTACTCATTTTCATCCGATAGACCCACACAGTACACCACTCAGCGCTAGAAAACA
CGCAACGCCTTCGAATGGCTCTCCCTCGTCTACCAACGGAAGTAGCAACGGCACCAACAGCGCCGGTGCGGTTCTCCAGGGCTCTTTGTCGCCCTCATCT
TCCTCCGCAGCAACAGCTACATCAACAGCGGCGACCTCGACATCATCAGCGATCTCGCAGCTTTTCTCGGAGCCCATCGCGTACGTCTGGTTTGACTTCC
ACCACGAATGCCGCAAGATGCAGTGGGGCAACCTGTCGAAGCTCGTGACGGAAGTGAACGACCAATTCAACCAGTACGGCTGGTTCGAGTGCGACGGCGA
AGGCCGCATGACGAACCGCCAGAAGGGCGTCTTCCGCGTCAACTGCATGGACAACCTCGATCGCACGAACGTCGTGATGAGTCTCTTTGCGCGCCGGTGC
ACGCTGCAGTTGCTCGGCCTCCACGACGAGGGTAAGGCGACAGCGAACGTGCTCGACTCGCCCTACGACGCCTTTGAGCTCGTATTCAAAAACGCATGGG
CCGACAACGCCGACTACGTGAGCAAGATGTACGCANNNNNNNNNNGCGCACTCAAAACCGACTTCACGCGCACGGGCAAGCGCACGATCTCCGGCGCGTG
TCAAAATTTCTTGTGCCACTTTGGCAACACAGGGAAAAAAGGAAAGTGAGATGTCTGTGGAGAATGCGGAAAGCACAAGTTGAAGTAAACATCACTCTTG
CTTTACCTCTCCATGTTGAACCATCATTCCGACATGGCGGATCAATCGGACCCCTGTTGGTCAAAAGAGGATCACATCAAAACCACAAGTCAATCTGAAT
TTGGTGTGCAAAACACCAATTAATAGACTGATTTGATTGGCGAACAAATAATAACTACAGTTGGTCCAATAAGTCACNNNNNNNNNNATCCAGGACGGCG
TCAACTCGGTCACGCGCTACTACCTCAACAACTTCTCGGACGGCGTACGCCAGGACTCGTACGACCTATTGGTGGGCAACTACGTGCCGGACAAGCGCGA
CGAGAGCCCGTTTACGTTCCAGCAGCAGCACAGCCTCGTGGCTTTTATGGCCGAGCTGAGCCTCGTGAGCCTCGTGATCATCAGCGTTTCGGTGAGCATG
CGTCCCGAGGAGGAGTTCGCCACGCGCGTGCGCGACGGCGCGGTCGCGTCGCTCGTGCTCTTTTGCGCCACAGGGTACCTGATCCTCAAGAAGGGCATCC
TGCGGTCGCTCGGACGGCGCTACGTGTGCAAACCCGCGTTCTGCTCGAGCGGGTACATCAAGCGAAAAGACTCGTAGTCTTTGGAGCAAGCAAGCAGGTC
CAGCGAATCCCTTACACAAGAAGTCAAGAAAAATAGAGCGCGAGCCCTCGCAACTTGAGGTCATTCATCCGATAGTGCTCTGCTTTTTAGCTCTTTACAA
TAGATACAAACAAAATGAAATCTCTTTGAATTTGTTAGCGTCGCTGTTGATTGCATTTTGCATGCCGCAAAACCAAACACCACGCAGTAGCAACACCAGA
GAAAGCAAGAACGGCGCAGAGAGGTCCGAGCGCGTCCATTAATGCACGTACGCGCTTGTGTGTATATAGTCCAGTGTGAGAGCGACTGTATCGAGAAAGG
CTACCTACTGGCGATGGTGGTTGT