Description :
From Genome Similarity Track
Location :
Scaffold_758:7599- 10152
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_758-snap-gene-0.9NOP17
Pytir_DAOMBR486maker-pir_contig_758-snap-gene-0.1060S ribosomal protein L21-1

Sequence
2553 bases(100 bases per row)
CCAACTCGCACACAAAGTTGCGGAAGGACCCAGTTTTGTCCTGACGGCAATCTTCGACCACCTGCGTATTTACCGCGACGTCGAACGCGAGCGACACAAT
GCCTTTCTTGTCCTTCACCTCATGTGGAGCACCGAGACTCAGCGGAACGTGGATGCCCTGGTAAGGGAAGTCAGCATAACATTACAAAGAAAAATAGGTC
AGACATGCTGGCGTGAAAAGCGCCTAAGAAGCTCCATGGGGTGGGCTATAGCTCGTTTTAGGCTCGGACCTCTTGCTCTTTGCCCTCGTCGTCAAGTTTC
TTCTGCTGCGAGAAGCTCTGGATGCTGTCGGAGAAGCAGACATTGACAAACACCTACAGCCAGCACCATAACCATAAACAACAATGTAAGAGATCAAATC
CATTGAATCATCACACGTTTCATCTTCGAGAGGGCGAACTGTCAGTAATAGATTGACAGCCAGTACCTTCTTGCCGCTCTTGACCTCGCTGGTCTTCATC
ACGAAGCCCGGCTCCACGTCAATGTAGACCTGCAGCAGCAAGCAGAATCAATGTTACGCAAAGTCCAGTCATTTGGTTACAACCATAAGTACTCCTAATG
TAAACTGTTTCTTACCCCTTCTTGCTTTGCTGTCAGTCCGTTCGGCTCCATGACTTTGTTGCCAGGGAAGCGCGGCTTGAAATCTATGTATGCATAGTAA
CACCAGCAGAAATCCAGAGCATTCATTAGTATTACGTGCGTAGCTGCACTTGTGTCTTGGCCGCATGTGATACCTGATGCCTCGCCACCACTATTCCCAC
CAGCAGCCGCCGCTGCTTTCGAGCTGCTCAGCATGTCGAAGAGCGCCGCGTTCGCATCGCCCTGCTGCTGCATCCCAGCGCCTGCAGGTCCAGCGCTTTC
GCTCTCGATCTGTGCTTTCATCGTCGCGATGAGCTGTTTGTAGCCCTCCGGATCCTTACGCTCGAGATTGTCCAGCCACTTTGTCACAAATGCACAAAGA
GAAGAGCACGTCACATGATGTGGCGCTATGGGCAATAGCAACAGCGATAGAGACCAAAACGTACGTCAGCGTACTGCTGCATCGTGGTCTCGTCCATCCC
CATCGTAGTGGCGTCGTTCATCGTCACCCAAATGCGGAAATGCGGCAGTGGCGCCGCTCTCCGAGGTGTCCTTCCGCGTGCCCCTGAAGCGCCACGCTCC
AAAAGCCAATTCAAATTTCTTCCACAATTGTTACACCAAGAGAATACGCAACTCGCTAAAGTACACTTTATGGGGAATAAAGTATACAGTCCTGCTAAGT
GCGAACTCAAATGGAGCTCTTCATCCAGCCTCTCTGACCATCATCGAAGTGGCGCTTTGGATCAAAGTCTCAAGTCAAGTGGTGCATCTCCCAAGCGCTG
CGAGAAAGATCAACTGACTGTGTAAATGCCTGCCTGCACAGCAAACACACAATGCAAACAAAGGAAGGGAGCGCACGTGGGACGGATTACGACTCGTTCA
TTTATTTGCCACCTCTTGCGTGTTACAAATCTTCTGCTCTTCATCTTCCTCACGACCTCACAAAGAGATCACACAGCGGCGACGAGTGCACGCGAGACAA
ACAGCCCGCGAGACCGCCGCTGCTGCACCAGCGAGCTGCTGACGAAGAGGAAGAATGGAGGAAAACCTGAATGGGAGAAATTACATAAGGTCGACGAATG
GCTGTGGGGCCATGGTGATTGGCTTGGTGCCCTTGGTCTTCAAGGTGTAAGCCTCCTTTGGTGGGGTAGGCTGACGCTTGATGACGGCGCGGACTATTGA
CGACATTGGTAGACAAATGCAAGCGTGAGTCAAACGGGTTCAGTTCTACGTAATAAGGTACAGAATCACTCACCGCCAGTGGCGTGGGCCTCCTTCTTCT
TCAGCTCGTTCTCCTTGACGCGGGTGAGGAATCCCTGACGGCACTTGGACTGGTGCACGTGCTCAATGCGAACGTTGATGTGCTTGTGGATGATGCGGTT
GCCCACGATCTTGTTCACACGCACACCAACAGCGCGCTTGGTGACGTTGTACACGCGACCAGTGCGACCGTGGTAGAACTTGTGTGGCATACCCTTGTGG
ATCGCACCGTTCGCCTTGATGTCGACGTAGTCACCGACCTTGAACGTACGCAAGTACGTCGACAGCTTGATCATGCCGCTCTGGCGGAACGGGCGGGCGA
ACATGTCGCGCGTACGCGCGCGGTAACCGAAAGAGTGCGGCATTGTTGATTAGTTTCTCCTGCAAAAGCACAAACAGCACAGAGTGGGTTTGTTAGCATC
ATGTGTCGTCGTGCATCCATCGCATTACACTCATGTGTATGAGCTGGATTGGGCAAAGGGGCTGGTATGGTGTGGTGTGGTAAGGCTGGTTGGTGGCTGC
AGCTAATTGTGCTGCTGTTGGTTACGGGTCGGTCGGTCTTGCCAGCTCGGTCGGTCATTCTCGCAGACTCCAGTCTCTTTCACTCCGTCACTAGTGTCTT
GATGAGCTACTGGATTTGTTTCACACATGTGCTTGGTTCCCTGTCTGTTTTCA