Description :
From Genome Similarity Track
Location :
Scaffold_14:75982- 79744
Transcript NameFunction/comments
Physo_343033Hypothetical protein

Sequence
3762 bases(100 bases per row)
TAGATACAAGTCGGCGAACGAAGATGTGAAGGCGGTGTTGCGGCCGGTGCACAACTCGTTCGATGAGAACTTGTTGGAGACGATGTGCGAGACCCGATGG
AACGTGGACTCCGAGGACTTGACGAACGAGCTCTTGGTGTAAAAATCACGGGGATGACGGCGAGCCTGAAGAACAGGGAACTGCAGACATGGACGGGATG
ATCGGTGACGAGGTGAAGCTCAACACTTCGATCTTCGACGTCGAGGCCAAGGTGACGGCGTACTTCTTGTCAACGAGATCATTATAAGCAACGGCATGCA
CGACCTTTTCGTTAGGTAGGAATGTGTAAAGCAGGTTATTGAAGGAGGAAGTTATTGCCGGAGGACTTGGGCAAGAAGGTGAAGAACGAGCTCGAGTATC
GAAGTGGCGAAGCCAAGCGCGAGGAAATTGTACTCTGTGGTGAGTGCTCTTGCGTTAGCCGGACAAGGAGACCCGTGCGATCAAGGAACTAGGACCCTGA
AGAGAGAAGTCTGGAAGGTTTCCTAGGGGTGCCAGCTCCCGTTCAAGTTTTCGTCAGATCAAGACCAGAATCACACTACTGTCAAGCTCCTAACAGCGTC
AACTGCGCGCTTGCATCAGCGAAACCTGATCAAGTTCCTAGTAGCGTCAACCGCGCGCTTGCACCAGCGGGATACCGTCTGCAGCGCACAATGCCTTGGG
ATCACATCAGCGCCGACAACGACTAGCCTCAGCACCCTTGTTCTAGACGGGCGGGACACCACATCCATCGAGTACTCTACGTCACTCTATGCCGTCGTCA
GACGGTAAGGGATACATATTGCGGATATATGTGTATGGTGCGCCACTTGATTATGTTCCTGGCATGCGTCGACAGCACCAACATGAGTCGCAAAGTCGCT
ATGGCGCCGCCAGTTCTCAGCTCCGTCTACAGGAACTGCAAGCCGAGCAGTCGCCGACCAGTCGGTACCGACACCGTGCTGTATTGACTCAATACGAAGC
GCACCGAGATGACCGGATTCTACTGAAAGTCAAAATGACGAATCGGCCAAACGTTGCTACATGTCCACTCCATAAGTAGCCGGGATACTACAACTATGAA
ATGGACGAACGAAAATTGGCAATACGAATTCGAATCCACTTGACTTCATCTTCTGGAGATGGCGCCAGACAGCATCAGCAATACCAGACAGACAACTTCA
GCAGCTACAGACGTAGCATTGGCGTGGGTTCGATTGGCTGGGTTTGCTTGGTGACGCATCCGAGATACACTCGCAATTCGTGTTGTACAGTATATTAGAA
AATGAGCTCGTACGGATTTTTCGCGAAATGTTTTATGTAATTACGTGATGGGTAATTGTTTTTACGACGTTTTTACGAAATGGGTCTTTGTGCCCAAATT
GAGATTACTGGCTCCTGCGCGTTTGATGTCACCCCTCCTGCATTTCATACAAACAATATGACTGTTTTGGACGTCGATAACCCAGATGTCGCCCTTCCTC
TTTTCTATTCAAAACATAAAATGTTTTCGCATGTCAACCCGTGGATATGTCGCTTATCCCCAACTAATATTTATTTTAAGAGTTGCTTGACACGTCAACA
TTTTACCGTGGGATCGGCGCTACGAAAGCGTCATTCAAAATATTTCCTCGCCGTGAAAGTGCTGCTGCAGCAGAGCAAGACAGGACGTGGGTCACAGCAT
CACTCGTCGAGAAGGCTCAAGGCTAGTGGAGTGTCAAATTCTATCTCGGTTGTTTCACGAATGTGATGCCAAGACGCTCCTGCGTTTGCCGTCGACGCTC
CTCCTGGAGTTTTGTACTGAGAGAGGATGCTGTTCTCAACGGTGCCGGGCAGCTCCGTGCACGTCATGGTGCTTTCAATCAAGCCCAGAGGCGCCCTGGC
GAAATTGAAGTTCCACAATTGCAGACTGAACGCATGGAATTTTACATGTAGATGTACAGTACTATTACAAGCAATTATATCGCCCGTATCGTGTTTAATC
CTATTAGAGAATCAATAGCGATGCGTTCTAGCATACAGTCGTGTACAATGCGCGTCTTGTAATCGGATCACTGTCCTGCCAATGGCAGTGTACAGTAGTC
AATCAATGTAGAGCGTTGTTATTCGATGCCGTGGACTTGGCAGCGCCAGCATGCATTGCACTCGACTCTGTTGGTTACTACGCGACTCGGGCCACTCCAG
GCCATTCTTCGACGCAATCGTCCAGGACAGGAGCCTCCCGTTCCCCTCCCTTGTTCACCTGCGGCGCCTAGATGCCGTCCGCAGCGCCAAAAAGCTTGTT
GAGAGCGGTGCGTTGCGATCTGTGAACAAAGCTACACCGGATGTCGACACCTACACTTATTCATGGTACTGTCGGATCCTCGAATCGGCAGCTTGCAGCC
AACAACAGTAGCTCACGCTACTGGCGGCCACTCCACCAGCCCTTGTAGCCAACAACAGTAGCTCACGCTACTGGCGGCCACTCCACCAGCCCTTGTAGCC
AACAACAGTAGCTTACGCTACCGGCGGCTACTCCACGGCCGGCCTCGATGCAGCTTGTCAGCGGCGTGAACCTCCCCCGCATCGCCCGAAGTGCTTCAGC
GCAGCAGCCGCCAGCGGCCGGCATTTTTGTCTCACGGATTTATGGCACATGGTACCACAATTGGCGTCCTTCCACCACAGATGGTACATGGTACCATAAT
CGCGTCCTTCCAGCACAGATGCGAGCCGGCGCTACCGAAAACCGATCGACGCAGTACCGCGGCTCCATCGGCCTGGAGCACAGCGACGGCGTGCGAGAGC
CTTCGGTGGATGAGGACAGACCGGTGAGCAAAGCAGGCGAGGACGAGGAACGTGATCTCGCGCTATTTCAGCGCTGCTGTGGTAGTATCGTGGTGGCACT
GCTCGTGTCCACGGCCACCGTGTCGGCTCCGGTCGGTCGTTGGGGGCAGTGATGTGAACAAGAAGCGCTTTGTGCGCTGAGACCGGCATGGCGCCGGCAT
AGACGTGCTGGTCGGAATGATGTTGGCGGCAAGCCACGTCGAGGAGTAGCGTGGAGTGGGCCGAGCGTCGCGTTTGATGGCAGCACGGAGGCCGGGGCGA
GTGGCGATGTCATTCTGTACGTGCCGGCGTTGCCGTCAACCGATCGACGCAGTATCGCGGCTCCATCGGCCTGGAGCACAGCGACGGTGTGCGAGAGCCT
TCGGTGGATGAGGATAGACCGGTGAGCAAAGCAGGCGAGGACGAGGAACGTGATCTCGCGCTATTTCAGCGCTGCTGTGGTAGTATCGTGGTGGCACTGC
TCGTGTCCACGGCCACCGTGTCGGCTCCGGTCGGTCGTTGGGGGCAGTGATGTGAACAAGAAGCGCTTTGTGCGCTGAGACCGGCATGGCGCCGGCATAG
ACGTGCTGGTCGGAATGATGTTGGCGGCAAGCCACGTCGAGGAGTAGCGTGGAGTGGGCCGAGCGTCGCGTTTGATGGCAGCACGGAGGCCGGGGCGAGT
GGCGATGTCATTCTGTACGTGCCGGCGTTGCCGTCAACCGATCGACGCAGTATCGCGGCTCCATCGGCCTGGAGCACAGCGACGGTGTGCGAGAGCCTTC
GGTGGATGAGGACAGACCGGTGAGCAAAGCAGGCGAGGACGAGGAACGTGATCTCGCGCTATTTCAGCGCTGCTGTGGTAGTATCGTGGTGGCACTGCTC
GTGTCCACGGCCACCGTGTCGGCTCCGGTCGGTCGTTGGGGGCAGTGATGTGAACAAGAAGC