Description :
From Genome Similarity Track
Location :
Scaffold_12:75975- 77467
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_04592Hypothetical protein

Sequence
1492 bases(100 bases per row)
GTTTTGCTTCATGTAGATCTGCGACCGGAGGAGGAGTGCCTCCGCCGATGTCGGGTGCTGGGAAAGGACCGATGTGAGGTCGTTGATTGCAGCGTGATAA
TCTTGAAGCTGAATATGAATATGCGCGCGCTGCAAGTGCAGTCGATGGTTGCTTGGACAAATGCGCAGCGCCTAGGACCACGAGCCATTGTTGATTGTGT
CACGATCGACGCGCCTACCGAGGTTAGATCTTTGAGTGCCTGGGACCTACAATGGTCATGTCTCAGCACTCTGCTTCAGGCAATACACGCACCAAAGACC
AAGGCGTCGACAGAGCCGCGCCCGCAAGAAGATGGCTTCGACGAACTCCTTGTCCATGTTGATGCACGCGCACGCAAGCAGTGTGGCCTGGCGCCACTCA
CGCGCCCGTTCGGCGCGCAGTGCAGCTTCGTACATGGCTTCGACCGACGACTCGACGCCCGAGTCGGCGGTCGAACTACCCGGCGGCTTGGCTCTCTTTT
TCACATCCGTGCGGCGACGGGGACTGGCCGGCGTCGGCGACGTCAAGTCAACCTCATCCATTTCAGCGACGACGCTGGACGTCGTGGTCCGCGCTGCCGC
TTTGTCGCGCTGCTTTTGCGCAATGCTCATCGAGACAGGCGCAATATCGCCGTCCGGCGATGCCAACGACGCGGCGTTGAGTGCCAAAATGGCGCCCGCA
TCCATTTCTTTGGGCTCGAGGACCGTGGCGAGCTTGCTTGGCGCCACCTGCATGACACTGGTGACGGCATCGGCGAGAGCACCGGCGACGGCGACGTTGC
TCGACCGACGGCGCGATCGTTTTGAGGAGGATGTTTGCCGGCCAGAGCCACCATCGCCGAAGGCATCGTCGTCGACGGGTGTCATCTCGTCCTCGTCAAA
GTCGTCATCGAGCTGGTTCCCAAACGAGTCCAAATCACCGCTGCGTGGCGGCAACTTAGGGTCATCGTCGCCGTCCGACGGTGTCCATGGACGTGGATTT
CTGCCATCGCCCATCTTGGTAGCGTTGCCCGTCTCAGCAGCCGGCGACGACTCGACGGCCGAGGAGACGCGCCGCCGAACGCCGTTCATTTGCCGCTGCA
ACGTGGTCGGACCGAGGTATCTCTTGAGAATGCGCGACCGGTTGAGCACTCGAAGGACAAAGCTTTTGTCAACGTCGTCGCCGTAAAGGGGTGGCATCTG
CAACTCGGCGAGCTTGGCCTCGATGAGCTTGTCATCCAAGAAGGCGTCGTCCAAACCGGCGTCATCGATGTCCATTTCAAGCAGCTTCATTCCAGCGGCC
GCATCACGACGCTTGAGGATGTCGTTGCACGCTGGTGGCGCAGCAAACCGTGCCGGTGCGAGCAAGTGCGACAGCGAGATGATGCCAAGCGGTGGTGCCG
ACTCCAAGTCAGGCTCTGGCGTCGGCGCCTCGACGTCGATATCGTCACTGTCTTCCAGAAATGTCACGTCCATCGCCCGCTCTTTGAACGGT