Description :
From Genome Similarity Track
Location :
Scaffold_501:7596- 10954
Sequence
3358 bases(100 bases per row)
GCGGGGTAGAATTCGAGTGGGCCTTTCATACACAGGATGATCCACCAACTGCCCTGCATACTCTTCCACTGTCTCTTCCTCACGTTCCGTAGTCACTTCA
AACGCTAGCGTTTTCCATTCTGTATCGCCGTGACCCGATCGATACATACCCTGGTGATCTAGGTATCATGTCCGATGTCATCCACAAAGCCAACGAAGCT
CCATGATTTAAAATTATTTCACGATCGCTGAGGTTCGTGAGCTGCAAATACTTGATCTGATCGGGCCCATTAGTCACTGTCGGCACCCACGCCACGTCTC
GCTTCAACCCAAAGCTTAGCTTTAGGTGGGCCAACCCCAATACGTACTTCTGTCGATCTGCCAACCGTTATGTCCACATGTTGATTATTCAGGTTGATCG
CCTGCATGGTCGATCGATTAGGTGGCTTCCGTCCTGCCAAACTAATACGCACCTCTTCAGGTAGACATAATGTTCTGTCGGCTAATTACAAACGGATGCC
CGCCGGAACCATAGAATTTATACCCAATATGAATTCTTAGCCGACCTGACCACCAACCCAAACGTCGAAATAATAAACCAACGATCCATCCAAAGTGATC
TTGATCTTCGTCCGTCCCACCGTCATATACGTGTTCTCTCCAATTCCGACGCACTCTTGTGTTTGACTGTCGTCGATCACACATCCTACCTTACGAGCAA
AGGTAGTATCGAGGATCGACATTTCAGCGCCGGAATCGAACAGCATCGTGGCTTTCTCATTGTTGATCTTGCCAACCGCTTTTGCTTGCTTGAACCATTT
CCGGGGGTGTGGTATTTCCAATACCCGCGCAATTTCCCTGTCGCGAGGTCGTGCTCCATCCTCACAGGCGATCGGGCGTAATCATCCACTCTTTTCTCAC
TTGATATCGACGAGACCAGTGTAAAATCTATATGTAGATTAGCGATTGGATCGAACCGGTCGTTAACCTCTTGATCTCTTCGTGGTCCTTCCACAAATGC
ATAAATGAAAAGCCTAGAACGCTCGGCTCGTGCCAGATTCCAACCTGGCGAGCGTTCTAGTTTAACATCTCCTCCACCCTGGGCGGAAACATTCCAGCAT
GCTTCGTAGGCACGTACCACTTTCGGACCAAATTGAAAAATTCTTCCATGAAACACTTGTCACTCTCGTGTATATCCCCGCAGGCTGCACACACGAAGAA
ACATTTGTCAGAGGGGTGTCCTTTGCGACCACATTTCTGGCACATCAATCTCGTTCAGCACCCGCGATCATCGTATCTGGTAGATCCACAATGGGTGCAC
GCCTTCTATCGTCCACTACGATCTCTTCCCTCCCCTTCACCAGTGTTCTTCTGCCAGGTGCGATGATCCTTGTTCGGTTTTTCTTCGTCGGGTGCAGTTG
TTACACAAACACGAGGACGATCCACTTCTTTCTCGGATCCAATCGACTCCGATTCCGATCCACTGCTCTCGACTTTCTCGCGGATCGCTCGCACCGCCCG
AGTCGTCTTGGACGCCATCGGATTTGCAGGTGCGATCGCTCGCTGATGGAATTTGTTTGATCCCATCGACGATGTCATCTGGAGATTCTCCATTCGTTGA
CATGCACTGAGAGTTTCTTTCATCTCATCAATATCCATCAATCGCAGTAAGGTCAGCTGTTTTGCCAGATCGCGATGGTCCAGCGTAGCAATGAAGTGTT
CCACATGCCCGCGACGCGTGGCCGATGTAGCCAGTCTTTCTTCTTTAATCGCGATCTTGGAATGCGTGGCCGCGACATTAAGACGATGCAAGTACTCCAG
CGGGGTTTCTAAGGATCGCTTCCGTGCGAGGTAATACTGTCTGGCCACTGACACACCTTGCCCTCCATACTGTAACATAAAACAATCCAGCAATCGTTTC
CACTTATGCCGCGTAGATCGGCTCAGTTAGTTGTACTAGTTTCGCGCGGGTCCCGTCAACAGATCACCGAACACCAAACACTTTTCTTCATCTGGCGCCT
GATCGCGCAGGAACGCCAACTTGACCTTGCTGATCCAGCTTCTGGCCCGATCTTCGTCTCGATCTTTGCCACTAAATTCCTTCATCTCCTTCATCGCTGA
CACTCGAATGCGTTGGGGAATACCACCACCGTTTTGCAACGTCTCTGTGGTGGCTACCATCGCACGTCGCCGCTCTTCTTGTCCCGACTCATCGGGATAG
GCATCTTCGGAATCAAAAATGTCAGATCGACTGAGATGCGATCGCACCGATTCCATCTCAACATCTGGGGTATATGTTTCTTGGACTCTTGCCGGCTTGA
TTCTTTGGCTTGGGTAGGCTGATACGCTCGTTCCCGTTGATCTTGATGAAAACGTTCTATGGCCTCATCGAGGTACGTCCGCAGGTGTCCTTGCACAGTT
GACGTCATCTGTCCTTTAGCGCATGATAGTCGTTTGCAGTTCAATCTTGATCGTCTCAACTCGATCGCGTAGATGTGCCGCCCTACTTGGGCCTAGAGAA
ATCCGCTGAATACCGACCGAATCATCCGACTCCATTTCAGAGTCATCCGAGGCGTACTGCGACGATCTGGTATGGTATCCTCTCGGGACATCGGCGATCG
TAGTGGCAGCTTAATCTGTGGATTCGCACTTACCCGTCAGGGGGTTCAACTTGTTATATAGCCATCGACACGCGTGGATCACCTGATCTTGATCGCACTC
CAGCAGTTTGTTCGCGTCGAACACTCCAGCAACGTATCCAGCGTCATGTAGTAGCTGGATGATCGCGTTGATCCCGTCCAGCGGGTTAGTTGTCATCGTC
GGTGGGGATATCGGACCTTGAATCTCTCTGATCAGCTTGGGCTTCAATATCTGGAGCACTGGATCGCTCGATAGCAGATTCCTGAGCGCCTTCCAGTGAT
ATCCCTGCGCCAATTGGTCCAACTGCCAGCCTTCCATCTTCATGTTATTGTCCACGAACTTGATCGGTCGATTGATCGATTTCACACTTCGATCGTGTTG
ATCCGATCTGGTCTCTTCTTTCTTCACTCGATCTGTCTTCACAATCTTCTTCTTCGACATTGCGTGAGCAGTCTTGTGTAGTTTTTCTTCAGTTTTCGCT
GAAGGGTTTTCACCCAGCGGATCGTGCTATGCAGCACGATCCGCGGTGGTCCCAGAAGGGACCTCAGAAGGGGGTCGAGGTTTCTCTTCCAAATCGATCT
TCCTCTTTGATCTTCTTGTCATCAGAACCCCTCCATAAACTCTGACGATCTGGGTATCTTTTTAAAATCACACGTCTGCGGCGATCCCTCTGCCTCATAC
GCTTCCATTCTCAACCTTGACCTTCTCATCTTCACTCAGGGACTCACGGTGAAATCCC