Description :
From Genome Similarity Track
Location :
Scaffold_46:75917- 76952
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_09460Hypothetical protein

Sequence
1035 bases(100 bases per row)
GGTGCGAGTCGGTTTTTCGGAGACTGCTTTGGTGGTTGCTTGTGACTGTTGGCGTAAGATACGACACACATTTTGCCAAGACGAGATTGGCTACGAATAA
TTGACCTAATTTAGGATGTGGCGGGCGTCCGTGGAATAAGTTAATGTTTTCCCACTTATGAAACGTTTTAGAGGAGTCAAAGGGCGCGGTGTCGGGTCTG
TTCTGTGAGGTATCAAGTGGAGGACAACGATGCTTGTAGCCATCTCGCCAGGGTCGTTTGACTTTGATCGACCACTTGAGCGATTTGGCGCGCCTCTTCA
AGGCGAAACGGACTGCCAGCAATCACGAACCGTCGTCGAAGGCCCGACTCGTGGGGCTGTAAACGACGCGCCACGCCGCGCCCAAGGTCCATGCGGTCAC
GAAAGACTTCCAAGACCCGTCACGCAGCAAAACTCTGCGGTGTCAGTTACCTTGCCCACCACTGCTGTTTTGGTTTGGGCTACTGAGACAGATACATTTG
CAGAAACCTACGCCTTCAACCCTTTCCCCAAGCACAGAATTGTCAATCTAGGACGTGTTTTTGGTCACTTTTGCAACTGGGTGCGGTTGTTGTGTCGTTG
GAGTCGATGCCGACGTCTGTTCTCGAGGGGGTTGGGCTACATGCCGTCGACAGGTACTAGTACCTGATTGGTTCGGTTGACAACTTGTGCATTGGTCGTT
CCAGGTAAACGTAGTAGCATTAGAGTAAAAAGTTAAAAATTGTCGCATGCAAAAAGCAAAATCAAACGTTCAGCACTCGGGGTACACGGCGCGCATTTGC
TTTTCGAGGACGCCAAGCACTTGGGCGGCGGTCGGGCGGTCCTCGGGCTTGTGCTGGAGGCACCAGTTGGCGAGGTCGGCGTACCACTCGTCGCACTCGG
GGCTCACTTCGGGCCGGAGCTTCCCGGACCGCACTTGGTCGAGGATCGTCATGAACTTGAGGTTAAGGTTCGCGTACGGCGCCTGGAGCGTGTCGAGCTC
AGTGAGGATGACGCCAAGCGAGTAAATGTCGGCGG