Description :
From Genome Similarity Track
Location :
Scaffold_161:7591- 11640
Transcript NameFunction/comments
Hyaar_Emoy2811547hypothetical protein
Hyaar_Emoy2811548hypothetical protein
Hyaar_Emoy2811549hypothetical protein

Sequence
4049 bases(100 bases per row)
CGTTTAGCATACGGAGCAGCTCGTCCTTGTTCAGCATCCACACGATCGCCATCGTTTGTGTCGATCAGGCTCTGTCTGTTCTTAAAGTAGTGGCGCCACA
GCGGACGGATCTTGTCCTGTCCACCGACGTTTTGCGCCTTGAAACTGATGTTTAATTTACTCCGCCGTCAGACGTTAAAGCCTACCACCGAGTCAGAGCC
ACGATTTAGACTGCTGTCCTCCATCAGATACAAAAAACAGAGTAACAAGTACCAGGGCAAGCATTTCTATCCTGTTTATCTTTACGTAATGCAGCTATGG
ACATCTCTTCACGTACTGATAGTTGAGATGGTCGTGATCAATTCTCCCAGCTTGAGCTTGTACAATATTGTGGTCAACCAGCAGCGTCAAGACCGACCAT
GAGGATGCTCATTTCCCTCTTGCCGAAGAGGCGCTGAATACGCTCGAGAAAGCCATTCCCATGATTGCTGACTTGTCTTGTTGGCGGCTATACATCGGAA
GAAACGGCCATCCTTTGCTACCGGGATTCTCATAGTGAGGTGTGCGAGCGAACACACGAAAACATGTTATTCGCTCAGGATCCATCCACTTAAAACCTGC
AAGAATTATTACTTTACCATTCGTCGAAAGGGTTTGAATAATATTAGTTTTTACAATCAATATAATCCCTTATATCAGTGGACATGGGATTTGGGCACGG
TGCAGATTTTCCTTGGGTACGGTCCAGACAAACCCGTTTACTACATGGAAGAAGCACGAAACAACATAATTTTTAAAGCTGACCGCGATGGACCACGCTT
GGTCCTCCTGGGTCTAATCTTGCAACACGGCCAGAATGCCAATATCAGTAGCGACACTTTTAGTGCTACTTGCAGCACTGTTAGCTGTACAAAACTGCTT
TGGGCGTTGCCTTCATAGAACGGTGGATCGAGCCTCTACAATTTTTCGCGCTTACCTTTCGTTCGGTCTCGCATACATATTATCTCGGTTTTCTACTTGC
TTGCTGTCTCTTTCCGACTTTTATGATTCCCACTACACCTATTATATCAGACTACAAAAGAACCTGAGCTACTTGACTTCTCCTGCCGTTTCTCTGTGTC
CTGGAAACCCATTAGGTGGCCGTCCAGCATCGCAATGAAACGCTCATATTCTTCCAGCTTTTGCTTAAAGCCCGTCATCTGTTCTCGCAATTCGTGCATC
TCGTCGCGCACAGCCGAGTACTTCTTTTGCAGATCAGCGATCTGGGACTGCTCGATCTCCGCCTCATCCGTATCGCTTCTCACCGTCACCCCCCCACTTT
GCTGGTGCTTGCCTTGCTCTTCCCGCTTCAATTTCGCAGCAATAAGCTCTTTGTACTCAAGCTCAAGTGCCTGGGCGGTTGTCTGCAGTTCCAAAATATT
CCGCTGCAGGACAAAGTGTCAATATATGTTGGCGCAGTATCAATGGGACCTCTATCTGCCATTCATTTTACTTGTTAAGCAAAAAATGTCACACCTTTTT
GCGCTCGCGGGACTTCCGCTTGAGCTCGCACTGCTTGCGCTTCCGCTCAACGTCTGCAACGCCCAGGTCCGGCGCTGCGTTTTGTTCCTGTTTTAGTTCT
TGGCTAGCCATGACCGGTTCGAGAAAAGTAACAGAATGACCAATCTAGCCTTGGTCTAGCGTCAGCATGCCCAGATGCAACAAGGACGCGGAGGAAAAAG
ACGCGCTGCTTCGGTGCTCAAGTAGGCGTTTCGCATGTGCCCGAGCAGCACCTTGCGACGCCAAGCCGCACATTGGTTTACTACCAGTCACAGTGCTCTG
CACCGTCCGAGCGACGCAGCTGGATTCTCTACGCTAGTAATGACTTGAGAATGGAAAAGCATAATCAGAGATGCGACTTGAGATTTGAAATACGCTCTAA
GGCCAAGTGCGCGCCCATAGATTCGGCCGGTCGGAGCTGGTGCTTGCGCATACACTTGCAATATCGAAAGCTCGAGCGGCGGTTTGAGCTCCTCGGCTGT
GTCCAGTCAAATCTTCCAGGCACTCTGAGCGGGCAGAAAGCAGCGTTTGATGCCTCTGCGACGGCTCTCGTCAGTAGTAACCCAATCCGAATGTCCAGCT
GTTTGATGATGACCGCCTCCAACGCTGAAGAACCTTCAGCAGCTGACTCTTTGACCACGCTCTGTTGATGATATATATAGTATTCACCAGAACCTTTGGC
GACCACTTGGAGAACCCCGTCCTGAAAAAGGTTCTTTTTTGTTCAGAGCCACGTCATCGACGTAGCAAAAGTCCCATATACATTGCTGAATAGTGGGACC
CTTGGTTGTGTGGCTGGATCGCATTTGAGTTGGGTTTGTTCCTGGCAAACATGTCATCGCTCATCACTAGTGGCGAGATAACCCTTCTTGTGCAGGAAGT
GATGTTTCGCGCGCTGGTGGTGTGAAATGTGTGACGCGACGGCCAAGTGTATGACACAAAAGCGTTCGTCATGTTGTTGCATGTGGTAATAGAACGAACG
CTCTCAGAGATTACGGACAATCCGCGCAATCTGATTGCGCGACGGAACTGGCAGTAATTGCTACCTGAGGTCAGATAAATAAGACCGCCAATACAATAAT
ATTGTCCAGGCTCGCTTTTTAAGCGCCTCATTTGTAAGTCTGCCCACGCCTTATCGTCTTAAATAGTAAACATGCATGCGATCGAGTGAGGAGTGAGTGC
AGGCGTTTGGTAACTTGTGCGGAATCAAGATATCTACGCTATGCGTCGATCACCCGCTTGTATACCTCGTTGGATAGGGGAGTATGCCAAAGCGCGTAGG
TCTATTGTGCAGAGTTTGACCAGCGCGGCAAGCAGAAGGCTGATCGCAACTGCTGAGCCATGAACGGATGCTGTATGCACCCGTTTATTACACCAGATGC
ATTATGCGACATGAGGGAAGGGGGTCCCTGCCCAAGCTGAATTTCCGATAAGTTGTTTATTGGTTCACTCGCCGGCAGCCGTGCGCATGACCCAAAGCGG
TATGGGCATCTTAATTAAAAGTCGTACGACCCGAAAGAAGCGGTCTAATGAACGATGGGGGCGACACAAGGACGTAATTGAGCGCCATCATGCATAGTAT
GTTACTTCCACTAGCTCATTGTTTGTGCAAGCTTAAGTCCGAGAAGGATATTTCGTCAGCAAGGACGCTCTTAGGCGGGTGTGCTACACCACTAAGGCGG
AAAAGATAGTGAATACCACTTTATTAACCACGACCTGCTGAGCGAGTCTCTTAAAGTATCGTGGACGTTACTGCAGAGCCACGGATTAGCACTTGTTGTC
TACAAACTGGGTTATTGGTGCACGGCCTTGTTTCTGTTTTCGCCTATAAAGACAGTATAAATGAAAACTTTTAATCGCGAACCAGTTATTAGATATCGTA
ATGCCCTGTTGAGCTCGATCGTCATCTTGAAGCCTCTGTTGTAATGAAAATTGCACGCAAAGCTGATTCACAAATATTGTCTTCGGTCACGCCAGCCTTC
TTGGATATCTCCCAACTAAATCCAGCTTACCGATCACTGCCTCTATCTCGCATTTGACCGAAATTCGCAGTAGGCAGTTCGATGCAGCACCACTTAACCA
TTGTGGCAAGAGTCCGTGCGGTGCCCTATAGCGCCTAGTACATGCACGCACTACTCCTCGTATGGCTACCAAAAGACGCAAGATTCTACTTTATAATGTG
TTGGTGCATTTACATAATGCAAATTAATGTACGCACCCCAACCAACTTCAATTCACATTTGCTACCGTCACAGCAAACAATCGGCTTTTTGTTCTGGTAC
AACCCCGTGGACATGTGGATCGTAGGCTCAGCTGAAGTTTTAAAAGGTTTTACCATTGTCTGGGTTCAGCGGAGATACTTCCTGCTTCGATGTTGATGCG
AATACTAGATCACCGATAATCCGTGTATTTTAAAGGTTAATACATATATTGAATGGCGAAGATGACGATCTCTGTGTCGAGCTGTGTGTCAGAACCAAGG
CTTAGTTGACAGTTTTGAATAACTTCTCTCTATATACCATGTCATCGAT