Description :
From Genome Similarity Track
Location :
Scaffold_100:7590- 11433
Transcript NameFunction/comments
Phyag_g2036hypothetical protein PHYSODRAFT_352574

Sequence
3843 bases(100 bases per row)
TCCGACGTCCATGATGGAGGGCGCGCGCCAAGGCCTGTTCTCGCCCACGAACGCCGACGGATTAGGCCCCGCCGCggcggccgccgccgcagcagcaacg
cccaCCGCGTCCCGCTCGCGCgcgtcgctcagcagcaaactcagcATGGCGCCTGATGACGCATTCGCGCGCGAGCCCGAGTGCGGCGTGTGCCACAAGT
CCTTCAACATCttgcgccgccgccaccactgccgcaGCTGCCACATCGCCGTGTGCAAGGAGTGTGGGCGTAAGGCCATCGACCGCAAGAAGCCCGAGCG
GTCGCGGCCGCAATGGTACTGTATGGGCTgtctggacgaggacgccaCGCTCGAGATCACGGGCTCGAGACCTTCGGTGAGCAAACGCCGGAGCTTCTCG
TCTACGTCATCATTCGCTCCAAACAACACTCAGCCGCAAGTCACTAATGTGAGTAGTTTTGGATTTTTATACTTTTTTTCACaacgcaagttgaagtgcg
aCAGGTGTTTTTATGAAGTCTCACGGatacatttttttttacttgaTTGACAGTTGGCGAGTACTGCCAAGTTTTGTATTGAGTGTGGCAATGAGCTGCC
GCCGAGAGTGAAGTTCTGCATTGAGTGCGGCACGTCGGTGAGGCAACAGTTGATGTCGCCTGTGAGTGTGGATGGGGTGGGGACTGCAGAGGTGGATCGA
GGCAATCGAGGCTTCCGGGATTCGTTGGGGTCGAACCTCATGGTCATTGACGAGAACAGTGGATCGCCTACAGAACCAACGGACGGATCGGAAGATGACG
CACCGGTGGATCAGGAATCAGAGGAGGAATTATCTcaggtggagaagaaagtggaggtggagaccccggaaggagacgatggcgttgcaacgaaggcgaa
ggaATATGAAGAGCTTGTGGCGCAATTGCAAGCGGAAAACGAGAAGTTACGGACTCGTGTGGAGAAGTTTAAGCGCAAAGTCTCCGAGGCGGAACGTCGT
CGGTTGGAGAGAGAGGAGGAACATGCTCGTGCAGTGTCGGAGGCTACTGCAgctgccaccgctgctgctactgctgctgtagagGCGCAGGTGAAAAACC
GTAGTGCGTCAGAACCGCCAGCTCCAATAGGAGTTGCATCTGAAGTAGCGGAGGCACCTGCAACCAATGGAGCAGGAGTTGCTGCGCAAGATCACCCGGA
CTATTTGAAGTTTTTTAAGCTGTTGAAGATGGGATTGCCTGCTGAACAGGTAAAGTTGAAGATGCAAGCGGCAGGGGTGGATCCGTCGATTCTTGATGAC
CCAGATGCGATTATTGGAGGTGCTGCTCCAAACGCAGATACTGCTTCAGCCCCGCCTGCGGCATCTGGTGGCAGCCTGGTGAAGGACGATGAGCAGTACG
CTAAGTTTTTCAAGCTTTTGAAGATGGGAATGCCAGCTGAGCAAatcaagctgaagatgagTGCGAGCGGCCTGAACCCCGACCTTCTTGATACACCAGA
CGCACCAATGCCCGGATCTGGtagtggtgctgctgcagcgccagcggcgTCTAACCAGGTGACGACCGTGAAAGAAGACCCTGCCTATGAGAAATTCTTC
AAACTGGTGAAAATGGGAATGCCTCCTGAGCAAGTGAAGTTGAAAATGACTACCGCAGGTTTGAATGAAGATTTGCTAGACACGCCTGATGCACCGTCCC
CCAACCAGAAATCGGGTGGTAGtagtggtggcggcggcctTCTTGCTGGACTTCCTCCCCCGAAGGAAGCAGTAAAGGTGGATCCGTCAGCGTTGAAGGC
AAGTTTGGCGTCAAAACTGAACAAATCTGCTCCCAAGAAGCCCGAGGAACCTCAACTTCCTAAGAAAGAAACCGTGAAGCCGAATGTCGAGTTACGCCCC
TTGTTTTGGACTCGCGTGCCCGTCAACGTAGTCAGTAGCACAGTATGGATGAAGCTGAACGATTCGCATGCCGAGCTGGACGTAGATGAAATGGAGTGGA
TGTTTCGCAAAAACCCAGTGGATGCATTGAAAAAGCTTGATGAAAAAAAGAAGGAAGCTGAGAAGGTGCCAGCCCAGCCCAAGGAAGTGCTTCTGTTCGA
CCCGAAGAGGCAGCAAAATGTGTCGATCGCAATTGCTCGATTCAAGATGTCGTCGGAAGACATAAAGAACGCTATCTACGCTTTGGACGGACAGAAGCTG
GGCTCCGAAGTGCTTAATGTGCTGATTTCTATATCTCCTACGTTGGAAGAGATTGACATGCTCAAGAATTACGATGGAGATGTAAAGCTGCTAGGAAACG
TGGAGAAATTCTTCCTCGACTTGCTGACAATTCCGCGCTACACCCAGCGGATCAAATGCTTTAGATACAAATTGCAGTTTGAGAATCGTATTCTGGAAAC
GCAGGCGCAGCTAGACACGTTAGTAGCTGCTACGGATCAAGTGACTGAGAGCGACAAGTTCCGCCGTGTTTTGGAGCACATCCTGGCGATCGGTAACTAC
TTGAATGGCAGTACAcctcgtggtggtgcgtACGGATTCAAGCTCGACACTCTGATGAAGCTGCATACTCTGAAGTCGGTCGACCCACGTGTCACATTGA
TGCACTTCCTCCTGCGTCAACTGGAAGAGAAGGCCCCAGATGTCATCACttttgctggagaagttccaCATGTCACTGAGGCAAAGAGATTGTCTCTGGA
TCAGCTACGTGCTGATCTGTCTTCTTACAACACCGAGCTAGCTATGCTGAAAGGCCAAGTGCGCGCGTCAAAAGATGATCACATCGAGGGCGACAAATTT
TATGAGGTTATGACTCCGTTTGCTAAGGACGCCGAGGAGgtgctcgaggagctgggGCGCGACTTTAACGGCCTGGAAACTTCTTATCAAGATCTAGTTG
GCTCCTTTGGCGAAGACCCACGAAAAGTTGGCCCCATCGAGTTCTTTTCTATCCTAGACGAGTTCGTGACGGAGTTCAAGAAAGCGTATCGTCAAAACCA
AACGAAGGAATATCAAACTATTTacgaagaggctgctgcggcgcgtgctgctgcggaggctgAGAAGGCTGAACGATTAAAGCGTGAAGCCGAGGAGCGT
CAGCGGCAGGAAgaggaacgacagcaaaATTCTGAGGAAACTAAGGCAATCTATGCCGAGATTATGTCAATCATCACGACTTGGGCTGGGAAGCATTCGC
CAGGCAATGAGGATGCGGTGATGGATCAGTTCAAGGACACGTCGCGGCGGTTTGGCATGGATGAGATCACAAGTGACGAATTCTGTGATCAAGTGCGGCA
ATGCGTCGGCTCGAAATGTGCAAGCAAAATCATTCCGAACAGTGTAAAGCTTTTGTCTGACGAGGAGAAACAGAATACGTTGCTGGAGGCGTTTGTACGC
TTCAAGGAGCAAGTGAAAAAAGAAAAGGAGTCGAAAAAACAGCAACGCAACTCACTTGTATCCCCGCCGTCCGAGGGGCGTGAAAGGGCCTCCTCTGCTG
GTCGCAGGCGTAAtaaggtggtggtgccacTCCCAATAAAGGACATCGAACCTGTTGTCGGCGAAGAAgcacagctgctgcacaagtcTATCCTAGAAGC
AGTGTTAGCGGCGTTTGGTGGTgactcgaagaagatgaaatCGTTCACGTCACATACTCGAAAATACGGCAACGAGCAGATCACGGCGCACGAGTTTTAC
CAATATTTAATGGACTCCTTCGACCCAGACTTCGTTGGGCGTTTGGTGCCGGACCTAGCGCGTCTACTGCAGGATTCGGAGAAACGACACGCACTCATCA
GAGCGCTGTGCGAGAGCGCTCCGGGCTGGGCAAAATTCGCGGG