Description :
From Genome Similarity Track
Location :
Scaffold_1066:7590- 10415
Sequence
2825 bases(100 bases per row)
GTTGGGAAGTCGGATTAACCTTAACCAGATTTTGGTaaatcctgctacaccacaccAACCTTTGTCGACAGTAATTTTTCACAGCCAAGCCAACTGCCAA
CGTGTAGCCGTTTGTAAGCACAGAATACGTTGTGGCGGTAAGACGGCGACGCTGATGCTGGGTTTGGCTTCCTAAGTGGGCCATTATAATTGCATCAGCT
GACGCCGACTACGGTTTTGGCTTGAAGAACACCCCTTGATAGTCTCTAAAGTCAGTTATTTCCCGAAGCATAATTTCCAGCAGAACTCCCCAGTGATCTG
GATGCGCAGTGGCAGAATCCAATGAAACTTGATTTGTGCTCTGCTTGTTTCCCTTGGTAGTCTGAGGTAACATTCCCACTCGCCTCGGAAAGGCTGCTGT
GCGAAATCGGTCAAGCTCAGGGTTTCTCCCAAACTTTACCGGCTGATTGTCTCTCACCACATTTTCTGTTCCCACCAACTcctgttttttttttaatgaA
AAGCCATTCAAGCATTCCACGACCACTTCTCGCTCCGTAAACGCATGTCATTCGCACACCTCGCCTTGATAGACGGCTTTCAATATCTCACAAAGCAATT
GGAGACTACAATCATGGCTGCAGAGACATCGGTCGATGCTTCCGCGATTGCTGTCAGCTCACTCAACATTTTGAAGGGTACTATTCTCCTTGGAGAGATC
TGCGTGTCGCTTGAATGGATTTGCGCGTTGGGTCTGTTTTTTTCGTACGCGGGACTCGGGACGAGGTATCCAGTGATTCTATCTCCAGCGGCCTTTCTCG
CATGAATATGCGCCAACACAGGACAGGAATGGATAAAGCCGGGCGTTGCttccccccccccccccctccgGGCGCCACAGTGACGATCTTCTACCCATCA
CGTTTTGATCACAATGTGCGTCACTACACCGGGGGCATGAAGATTCGAAATCTAATTTCTGGCTTGAAAATTCAGACGCAGATCGATAGTATTACCGGGT
GTCGTGTCCGTTTTCACACTCGCGGAAATCTCAGAAATCTTCAAGCGTAAAAACGGGGACTGAGAAGGGTTTTCGTTTATTAAGCATCAGACTTCTGTTT
AAGTGGAAAGCACCACTTTTATCTCGAGCCCTCGTCGTGAATCAATTGGAAGTAGCGCACAGCACCAACTCTCTTCACATACTTTCCCATGCCACACACA
TCCGAAGTCAATCGCTCAAAGACCACCGTGGTTCGCTTGCTTGTCGCATCACCAAACGACATTCGCTTCGGCTTCGCAGACATACAGCTATGACAACGCA
GCTTGGTTCTCAGCTGCTCTGACGAAATCTTCATCCCTTTCACTACGCTGTTTTTCATCAAGAACTTTAGATCTGCTTCGTTCAGATGTGCCAACCGTTC
GTGCCATTTCATCATAGGATTAGCATCCGCACTCACTGATGTCATTACGACAGACTCACGAAAGCTCCCGTTGTTCAACCAGCAGTGTGCGGAGGGAGTA
TCAACGTGGCAAAATCAAAAAATTTCAAGTCcagaaaaaaataaaatcTCGATGAACGCTGACTGCGAGTCGGAATCAGAGAGCCTGCTGTTCTAATTTC
CATCAGCAATTGCTGAAGATCTTATTGGGAAGGTGTTTTCAACTCGGACAATGAAGACATCTCCGCAGAACTTGCGTTGCGGAAATTTAGCTCTAAACAA
AACGGAGTGTACAACGTGAAGATCAAGACCCACTACGTTTCAAACTTGCAGTTCAGCATCTATCAGTGGGATTATCTTTTCGTCAAACTGCCGCAGTCAC
TCAGCAACACCACGATGCCAATGCCAATCCGAAACTGTACGGCATGCATGACAACATAGTCAACTTGTATGCACGTTTGCTTGTAGTGGCATCTTTGGTA
ATCTTTTAGCAGAACCCAACATGTGAGCATTGCGTTTGCTAGTGGTATTTCTACACGCAACGATCGATCTTTTGTCATCAGCGAATTCACCTAGCTGTGG
ATGGAGTGATTGAACAAGAACATATCGAACTGTGCACTAAAAGCGATCTCGAAGGAAGCATTGAGACGGTTCTCAAAAAGGAAACGTACGAAATCAGCTT
CAACGAGGGTTGGGGTACCTTGCAACAAGTGTCACCCGGCAAGTATGCGAACCTCCGTCAATTTTGCTGTGGAATTTTTTGCTAACACAGCCTCTGTGGA
GTCTGATTTCTCCACCTTGAAGTGGGAATTGGGTGACCGACGTGCAGTACTAGCACCGCTAGATCTAGAAGTTATCTGGAACTTGTCCCTGAAGCTGAAA
TTCCTGACGACAACAAGGCTTTGGAAACTATGTGGCGATATCAGCTCAAGGCAGACACGGAAGGAAATCTCAATTTCGTCCACGACTGTTTGCCAGGGGT
GACAAGCGGGAGCCTGATATTGACTTCGTAGTTACGGATATTTTCTCTCCTATGGCGAGAATGGTTCATTCAGGTTGTTCGTGGCTCTGTGTATCCTGTT
GGGCCTAGAGCTATTCCAGCGTGACATCAACATTTATTACTTgaacgtgaagctgcagattctgcaCTTCGTTAGAAAAATCGCAGGTTTCCTATCAAGA
AAGGTCATGTGGACTAGGTGAAGAACGATTTGAACGGGTTGCACCAGAGCGGCAAAGAGTGGAATGACGAGTTACACCAGTGGCTGACCGAATATGGTTG
GACGCAAAGCACAACAGAGCCGTGTTTTTATTCCTACCACGTGACTGCTATTTTGTTCGTCTACGTTGATGATTTAGTGTGTGGCATCAATAGTGAGGAG
TGAAAGAGGCAGTTCTTCGCGGATG