Description :
From Genome Similarity Track
Location :
Scaffold_737:759- 3115
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_737-snap-gene-0.13WD-40 repeat-containing protein

Sequence
2356 bases(100 bases per row)
GCGGAGCAAGATGTGGAATGCGGCGCTGCGGCGCATTGTGCGCGATGAGGAGGACCGCGAGCGCGAGAAGCGCGTGGCGATGCAGCAGCAGATGAAGAAG
GAAATGCTCGCGGCAGCTACTACGGCAGCCGTTACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGCCGCTTCTTCTGCTACGGTCGCTGCGTCAGAAGG
TGCAAGCGAAGAACCAAGCGGCGCTGGCGAAAGCGAAAGTGGCGCTGCTTCCATGCAAGTCGACGAGATGAGCCATGACGCGGTTCTAGAAGAAGCAAAG
CATGAAGAGGATGATGAAGAAGAAGATTATATCCAGCGCCACTTGCTGTCGCGGCCGAAATCCAAGTGGACCTGTCTGGAGGATTCGCAGCAGGCGTGTT
GTCTTGCGATGAATCGTAAGAAGACCGTGTTTGCCGTGGGCGAGCGGGAAGGACGCATCAGCATTTGGGACAACGTCTCGATCCGAGTGATCACACGAGA
GCTTGATCCTACGCTGATTATAATTCCAGAGAACTCTGCTGCTACTACGGATGCTGCCAAGGATGGGTCGGCACAAGAGGCCAACGGCAGCAAAGCGCCT
GCTACAAACGAAACGAATGGGAAGGATGTGACGAATAAAGCTAAAGCTCGAGAGAAGACAGTGTCTGCTATAGAAGTAGACGCAGAAGACGATTCGGCGA
CGAACGATGATGGATCCGTCGAGGCCGACGAAGACGAAGAAGTTGCCTCGGCCGAAGATGGGGATGGAAATACAGAAGAAGAGGAAGACGACGAGGATGA
CGAGGATGAAGATGATGAGGACGACGAGAAGACCCGAGCAGCGCAGATGAATAAGGCTTTACCGAAAGGCGCTTCGTCCATGGTCTCTACTGCATCGGAA
TCATTGTTGGACAGAACCACTGGGTCCGGACTCTCGATCGAAGAGCTACGCATTGTGAAAGAATCTTTGAAGGTCGTGACATACTGCGCGTGGTCCTGTG
ATACGCGTTGGTTGTTTGCAGGATGCGAAGAGAAGAGCAATCGCCGCGGACGATTGTGTGTTTGGGATGTGGATGCCGCGACCATCTTTGCCACGTTCAG
GTACGGTCATATAGTTTATTGTGAGTGCGGTGCATGTGTATGGCATGTCACCTTCAGCTTACTGTCACGAGGCGAGTCGATACTAACCGTGATCTGTGAC
CATGTTTGTTTGCAGCTTTGATGCGGCGATCAACTGCGTGTCGGCGCATCCTGGGGACCCGGATGTCGTTGTTGTGAGCTACTTCAACTCGTTGCCGGTG
ATCTTGAATGTTCGCACCCGCGTGATAAAAGAGCTCGCTGTGCCGATTATCAACCCCACCATCAATACGACGGTGCCAGCAAATAGCCGACATCCGTCAC
TCATCGTGTCGGCAAAATTTGGGACAACGGGACAGTGGATTTACTGTGCGACATCCAAGTCCACGGTTGCCATCTTCGAGACCGCGACGCTCACTTGCAT
GGATAGCGTCACACTCGCCGTGTTGATCCAGTTTGTCGACTTGAGCATCGATTACCGTGAGAGTGCGCTGATTCTCACGAGCTCAAAGGGTGTCCATGAG
TACTCGATCAACACCTCGGACGACGCATCAACCAGTAAGCGCAGGTCACTCTCTGAAGTGCGTGCATACGCCACGGGTGCTGTGCGTGCGCCGTGGGCGC
TGTGTTGCTTCAGTGACGATGAGAGCTACGTGGTCGGGATGCCAGTCGTGCGCCACCGTCATGTGGGTGAAAACGGTCTATACACGTGGCACCGTGGCAC
TGGTCGTGTGCAGCACAATCCAGGCGTGAAGGATGGAGTCAACTCGTTGGCGTGGGATACCCAGCGCGAGAGTATCGTCGCTGTCTCGACGACAGGAGCG
TTGTTCGTGCTCGAGGAAGAGTTCACGACGACGTGGTCAGGGCCAATGTACCCTGCCGGATACCGTTTGATTACCGACAACGAGCTCCACATTGCATCGA
TGGATGCCGAGCTCGAAGCCATCGCCAAGGCCAAGAAGGAGCAACTGCACGATGGTCAGGAGATTGACATTTTCGCGATTGACGAAGTACCGAGCATTGG
GCCAACGACTAGCGTGCAATTGCCGCATTTGCGCGGGGAGCGACTCGAGCCTCAGGTGAAGAACGAGCTCATCTACATCCCGTCGATCGCGATCTCGCAC
CATCACAAGAAGCACCACCATGCGTTCGAGGGCCCGATGTATCACGAAGAGAAGCATTTTGGCCTCGGTCAAAGCATCTTTGAACCGCTGAAAGTTGGAG
TCAAGCCGAAGTCATCCAAGTCAAAGCGAAAATCGTCGTCCAGTAGTAGCAACCAG