Description :
From Genome Similarity Track
Location :
Scaffold_2292:759- 2289
Transcript NameFunction/comments
Phypl_g14921hypothetical protein
Phypl_g14922reverse transcriptase

Sequence
1530 bases(100 bases per row)
TCTCTTCCCAGGAATACGATGATCTGGTGAACGGTTCAGGCCCCGGGGAAGAGATGCCGGGGGGGGGCACGATGTTTTCCGCGCGTATCAAGGTATTTTG
ATTCGTTCGGGTACCCATGAGTGTCGACTTCTGGCGCGTGGTGGCCTTACACGTGATACACATGTTCACGTGGTGTCGTGCCTTCTGAGAGAGGTTACAC
TGGATCGAGATGGACCGCGCTGATCCTGGGAACAAGGCCCTGTACTCTGCCCGAAGCAATCTCCAGAAGGCGTGGGCAGCCGCTCGTctcaaggtgaaga
aggaaGTTCACAAGTTGCCGGTCAACGAACGCCAAGTCTTCCGGCGTGATTTCGGACTCTGGCGCCGGTCGAGGAAGGTGGCCACTTGGATTCCTATGGA
TGCTCAGGCACAGTTGTCTCTGTCGCAGCAACTGGAGATCTTGGATCGGTGTAAACCTGCACGGGTCTACTGGGGTCATCCCGGAGGGGAGGGCCGTCTC
TCGGAGGCCGTGTCTCCCAGGGTGTGGGCTACACGCGTCACTCATCCGGCCGACCGCCTGGCGATCCCCACTCCCCAAGGCCTGGACTTGCCGATCTCTC
GAAGCTGAATTTTTTTGTGACCAAGGGTAGCACCCGCCCCCGACTTTGGTACTCGGACCTCGCCGGTTCTTCAGCATAGTCGTTCGTCTCGTAGTGTTTC
CTTCCAACATGATTCCTCGTTTAGTCCTTGAGCTATCTTGTGGTACGCGTggtcttgatcttcttcttgtgaCAGGGACTTCTgcgagcacctcgaagtc
gGCACATCCCCGGGATCTTAGGCCTCCGTCTTCAGTCGATAACATGCATTCTAATACAAACATACAAATATACAAATATGCAGTGTCTTGGGTTCTCAAG
CGAGTAATTTCAACCAAGACCCAAGCCTTCTCGGGGGACGCTCCGGGGTGAACTACTGGAGCTCATCCCGGGTCCACGCCCCGAGAGCTCTACcggacct
cctcgtccgggaGCTCGTCACCTGACTGCATCGCTCGGAAGCGGACACGGGCACATTCTCCTTGGTCAAACTCGTACATCAATCGGCCACAGTTCAGTCG
CTCTTGGGGAATCCACTCGGGGACGTCGTAGTCTTTCCACTTCACCTTGTATTCTTTGACGCGTCGACTAGTGCGGTTCCTCGGGATCCAGCGTACATCC
AGGATGGTTTCCACTTCGTATTCTCCAGCATTCTCGTCCGATTCCCAGCTATCCTCTCGCAACAGCGCAGCGTCGAAATCGTCATCCTCGGGCATCTCCT
GGGTCTCGGTCGGTCTCTCAGGGAACACCACTCGGGGTTTCAGCCTGCTGACGTGCACCCAGGGAAAGAACCTGTAATCAGTCCCTTCGACCTGGAACCG
ATAACGGAAGTCGCTACCCTTTTCCAAGATCCTGAAAGGACCGTGCCagagcttcttggtcagtCCCGGGCGTACCCGAGGCAGGTACAGCCACACCGAG
TCACCCACTTCGAATCCTTCCTTGAGCCGG