Description :
From Genome Similarity Track
Location :
Scaffold_186:75895- 79526
Transcript NameFunction/comments
Hyaar_Emoy2812162putative polyprotein

Sequence
3631 bases(100 bases per row)
CTTCCTCTGACTTAAGGAGCTGTGTCGCTGCGCTACACTTGGTAGCACTTGTAGTCAATCTACATCTGAGTCTTTAAAGACTGATCCTCTGTGAGGATGG
AAAACCCCACTCCCTTCTCTGAGGTCAAACGGTCGCGCTTGATAAGCTGACCGCATCTTTGGGTCCAGAGTATGTGGAATTCCTTGTATCGCAAGGCCCA
GAGGTGCTGACTGCACGTGTTGAGGGTTTCTTGCAGTATGAAACGTCCGTTATAGGGCAGATCCAAGACCAAATGGCGTCGGCTATGCCTACACGCTATG
TGTCTGTCCCAGACGAAAAAGCTAGGCCTCGTCCACTTAGAGTGGAAGTTAAAAACTACTCAGGAAAGGAGGGTGAGAACCTCATCCTCTGGATCCGTGA
GATTGAGGTGGCCATGAGATCAGGCCTGATCAAGCTTGACCATCAACAGGTCTCGCTGGCTATATCAAAGCTTGATGGAAGAGCTAGAGAATGAGCCTTG
ACGTGTAGCACGTCGGTCGACTTAGCGTTTCCCACATGGGAGTCGCTTAAGTCACAATTGGTACAGGTGTTTTCACCACCTAACCAGGCTTACCGCGTGC
GTTCACGATTTTTATCAACCCGTCAGGGTAAGAATGAGTAAACGGACTATGTCGAAGAGCTGAGAACTCTCATGGCTGCTATGCAGTCTGACCCTCTGCC
TGAAGCAGTCCATGTGACTATATTCATGGAGGGTCTCCGTACTGGCGTTGCCAGAACCGAAGACTTTCGGGTTCACCCCTCTACATTCGAAGAGGCTGTG
AGAATTGCTCATAATGCTGAGCATAATTTCAAGTCGGCCAGACTTGGCTGGAATGGGTACAACCCTAGCTCTGAGAGAGAAAACTCCACGAGTACTCCGG
CCGGTAATAGGCCGGAACCGATGGATCTCAGCTATGCTGAAGACGAAGTTGAAGTTGAACTTCAAGCTGCTGAGCAGCAACGTGTTGTACGACGTTGTTG
TACGTGCGGAAGCATTAAACACTTACGGCCTGGTTGCCCTTTGCGTAGACAGCGCCAGGCTACGAGTCAACAAGTAGGCACGGGGCGCCCTACTGGGGAA
GAACTAGGTTCTGTAATACCTTTAGGAGGTAAAGTTGAACAGGGCTTACCCTCAAAGAGTTCCATACCTACTGATATGGAGCGTGGATACAAGGCTGGCT
TGTTGGTTGCTGAGGAGAAAGTTAAAGGCTTTGAAAAGCCTTGGTCGATTTTAATAGATTCTGGGGCGTCTTGCAATTATGCTCGACGTCGTTCCCTTGA
GAGAAGTCAGGTTTATACTGAAGCGCTTACAGCGCATGAGGGTGATTCCATCACGATTCCGTTAGCGACTGAAAGTCGTGTCACTGTACCTAGAGTTCCT
TTGAACTTATGTATAAAGTATTTGGACTTTGATAGCATTGAACGCTGTCTTGTCCTTGATTTGGACTCGAGATATGGTCTCATCCTAGGTATGGCTTGGC
TTGAACGCCATGAGCCATGGATTGATTGGAGGTCGAAGACCTTAGGCGCTACGCGCAATGTTCCTAGCGAATCTTTGGAGAGTCATGAACCCACCTTGCT
AGGCAACAAAAGCACTATTTACGCGATCCTGAAAGAAGATGTCAATATGCTGGATATTGGAATGTCTAAGTTAACTAACTCCAATGTTGAAAGCATGAAT
TCTGAGCGTAGATCGTTGAATATTAGTGATACGGCACGTACTCCGTTGAGTGTTACTCGTTGTGATAACGAGTCACTGCATGCTGAAAGCACGGTTGGCC
TAGGGCCGAGTTATCGAGGATGTGATTCCTTTGATGTGCGTGTGGTGGCACGTGAAAATGCACCGAGTGCGTTCGGCCGTGAAGGCACCACACTTAATGT
CGGTAATGACATTGTTGGCGAAACGCCATTAAGTTCAGGGCTAGGCCCGTATAATGTAAGTGGAGTGGCACTTTTAAATCCACTGGGTGAAGTGTTCAAG
TTACGTAACACTTCGCCGGATGTCGATCAAGACATCAGCTCTCGTATAGAGCGTACTACTAGTAGTAGTAACCACGGGAACACTATTATCCCGACCCCAG
AGGGGTGTAAGGTCTCATCGAAGAGACGACCTAGACGCCAGGTAGCAACTGTTAAGCTCCAGGCGTCCGTGCAGTCACATAGTGACAATAGTGATACACT
ATATACACTTGTCAACGGAGTAACTGACCAGGTTGAGGGCAATGCTAGCCTGGAAACCCTTCCATCTTTGGATGCTCTTTGTGAGCTAGACGAAATGTCT
GATGTCGAGTTTAGCCAGGCCTTGAAGGCAGGAGATTTATCCGACTTAGTGGTCATTAGACTCGATGTCGAGTTGAACTCATCCACATTAATGGATGAGT
TGGTCCTAGAGGACACCAAGGCGGCACTCAGTGCCCGGAGTGGATCTTCGATCCCTAAGGATCCTTTGGATCCATTCTATCCTTTGGTAAAGAAATTTCA
AGATGTGGTGTGTCACAACCCACCATCTGTCTTACCTCCCGATAGAGGTGTACGTCATGAATTGACCTAGTTCCAGGAAGTAAATACTGCGTAACACGGC
AGTGGCCTTTACCTAAGGAACAGTGTGACTTCATTGACGATTTCTTTCGTGCTAAGTACGCGGCGGGGATAGTGCGGGAGAGTAAGTCTCCCCATTCCAC
ACCTAATTTTTGTGTCAAAAAGCCTAATGGTAAGTGGCGTATTGTGCACGCTTATAACAAGCTCAATACTGCCAATATCCCGGCTCAGACACCAATCCCC
AGAGAGGATGTTCCTCAGAAAAATGTGGTGGTATGTACATTGTACAGTGAGCTCGACTTAGTCGATGGTTATTACCAGCTGCTCATGCGAGCAAGCGACA
CTCCGCTACCAGCGGTTAGTACCCCGAGCGGTATGATCTGGGAGTGGCTCGTTATGCCACAAGGGCTGTCAAATGCTCCGGATACTTTTAATCGTCTGGT
GACGCAACTATTCAGACCTCATCGAGGCTATGCACAAACGTACTTTGATGACATCTTTGTCCATAGTCGTGCAACGAACGGTCGGTCTGATGTGGATAAT
CACATTGATCATTTACGAGTGGTGCTCGAGTGCATGCGCACGAATAAATTGTATGAAAATGCATCTAGTGCATCTTTGTAGCAGAAGAGATTCCCTTTCT
GGGGTGCTTCATTGGGAAGCGAGGCCTTCGAGCGGACCCCGCTAAGGTAAGGGCCATAGTCGATTGGCCGGTTCCAAAGAACCAAAAAGACCTACGTAAG
TGGCTTGGCCTTGCCGATTACTTGCATAAGTATAGTGCGAATTACGCAGATATGGCTCGGCCATTATCCAATCTCCTTAAGGAGGATGTGGATTGGTGTT
GGGGTAACACCGAACATGATGCTTTTCAAGCAGTTCAGGAAAGTCTCCTTCATGCGCCAATACTGGCTTTGCCCGATCCTGATCGGCCTTTCAATGTCGT
CTGTGACACATCTGACTTTGCCATAGGCAGTGCTCTGTTACAAACAGATGTCGATGGACGCGAACGCGTCATTGCATTCGAATCTCGACAGCTCAAAAGA
ACTATCCAGTTCATGAAAAAGAGCTACTTGC