Description :
From Genome Similarity Track
Location :
Scaffold_19:75888- 77104
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_19-snap-gene-0.60Cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kDa

Sequence
1216 bases(100 bases per row)
ACGGGATGTTGTTCTGCTGCATGAAGGCCATCAGCATTTGTCGCTCATTGGGCGGCAGCAGATCCAGCTTCTCGGGGGTCATGTCGCGCGCGAGCTCGGC
CACGGCATCGAGCTGTCCCTGTGCGGCACTGTCAGGAGCGCGCTGCCGCTTCGGCGGTCCGCCAATGTCCGGCTCCATCCCGCGCTTGGCCAGCCGCGGG
TCTCGGCGCCGAGGGTCTCGATTCCGCGTGGGAGGAGCACCCATGATGCCCGGTGGTGGCCCTTGTGCGCGCGGCGGAGGCTGAAGGATGCCTCCAATCG
GCGGCACCAGCGGCGCAGGAGCGGTGATAGGTGCGGGAGCCGCTGGCGTTGTCGCCTGCGACAAGGGACCAGGCCGAGAGCTCCACCGAGTACCACCAGC
CTTCGCGGCCGGCGGCGGCGCCATAGACGGCGTGGGCATGAGACCTGCCGGCGCCGAGGGCGGTGCCATGCCGAGAACCCCACCGACAGGCAGGACTGGG
CCGCGCTGCGGCGGCATTGGTCGGCCTCCCATGATCGGAGGAGCCTGCCACAAGTGATACACGTGAGGAGAGCACCAAGCCAACAACACAGCGAGAGTGA
AACACGCACCGCAAGCAGCGCCGGCTGTGACTCGGTCGAGCTCGGGATGGGGATCTGCAGCGTCTTGAAGGCCTGCACGATCGCGTGCGTGAGCGCCGGG
TTGGCCCCCAGGATGCTCTTGGTGTACTCGGGTTTCTGCCGCGCGTGCTCCTTCAGGTCCAGCAGCATGTCGTACAGCTTGAGCGGCCCGAACTTGGCGA
TCGCGGCCTCGATCGCGCTGATGGCCATCTCGCCGCTCACGCTCGGCGCCTGGTGGTGGCCGTGGTGGTTGTGGTGGTGGTGGCCCTTGTCGCCTCCGCC
GCCGCCTCCCCCGCCGCCAGACTTGTCCCCGCCATCCGCGAAGTCCACGCGCAGGTTCCGCCCGTTGATCTCGTAGCCGTTCAGGTTGCGCATGGCGCTC
AGCGCCGTCGCGCCGTCCGCGTACTCGCAGAAGCCGTAGCCCTTGGGCTTGCCAGTCTCGCGGTCCGTCACGAGCCTAAACCAGCAGCCAGTCAGCACGT
CTATGGAGGGAGCGAATGGCACAGCACCCACCTACCGGAAACTCATGACTGAGCCGGCCTCCGAAAAGACCTCCTTGAGCTGCTCCTCGGTCACATCGTA
CGGAATGTTGCCGACT