Description :
From Genome Similarity Track
Location :
Scaffold_139:75880- 79845
Transcript NameFunction/comments
Physo_143446predicted protein

Sequence
3965 bases(100 bases per row)
GTCGTTGAAGTTGGTGTCGACAGGAGGAGCGGTAAACCTGCCGTCGACTGCGCCTCCTATCACTGAGCCGTCGATGTGGACCCAGTACTCTGCGCTGACG
AAGAAACGTTTCCAGATCGCCAAGCGAGACAAGAAGACATTGGCCTACTCGGTTGGGATCCCTCTCATCTTCCTGATCATCCTCGCAGTGTTACCAGAAA
TTGAAGTGGCAGATTTCATCCCAAACTACGCCTCCAGCCTCCCCACGGAATCGGAGCAGAGCACATGTGCGGCGTCTACGAACTTCAGCAGTCTCATTGA
TCCCGACTATGATGTCTCGGCGTGTTACGGCTCCCGGGGCTTCGACTACTGCACCCTCGGGGTCGTGAACTGCGATGTCAACGTGTGCTGCGATGCCACT
AACGTCGCTTCGCCTTGGTACCCGTGCAACACGTGCGGCTCGGCGCCATGTTACAACAGCAACTGCCTCGCCAAGAACAACGCCAAGTTGCAGGTGACTT
TAAACGGCTTCTTAGTGGCTCTGGTCGTCATGCTGGCGTTCGCGTTCATCCCCGCAGCTATCGTGGCTTTCGTTGTTCGTGAGAAGGACCCGATCCAGAA
CGCCAAGGGCCTGCAGCTCATCAGTGGCGCCAATGTCTCCGCGTACTGGATGGCGTGCTGGACGCACGATGTCCTCCTCACGATTATCCCCATCGTCGCC
GCAGCGATCATCATCCCGCTGTCCATGACGCCGAGCGGCGCAGCGAACGCAAGCACAGCCGATGTGTTCGCCATTATCGTGCTGGTGATTGCCCACGTCT
GGGCCATTATCCCGCTGGCCTATTTGTTCTCGAGGAGGTACGTCAAGCACGCCGTGGCACAGACTGCGTTGCTGGTGTTCGCCCTCGGTACCGGCGGGTT
GTTGAGCATCTTCTCGTTCATGTGCCGCATCGTCAACTTCACGATCTCCGGTACCTTAACGCTGTCCTCCCTGGACCAGAACTACCTGCGTTGGATCTTC
ATGATTTTCCCTGGGTACACGCTGAACAACGGTATCTTCGAGCTGGCAACGCGGAAGGTTAGTCGCCGAGCTCTGTTTGGTTCAGCTCGTTGGATGCCGG
CGTCTCCGTCGTTCTTCGGGTTGTTTGAAGGCTTCGGCAAAGAGGAATGCACGGAGTGCTGGGACCGCCTGACCCCTTCGTGCTGCGTACGACAGCCCTT
TGGTATCGAGATCATCGGTGCCCCGCTGTTGTACACGCTGGTTGAGGCAGCAGTGCTGACCGCACTCGTGTTCGTGCTTGAAAACCGCTCGGTCAAGTGG
AATCAGACCGCCTCGGAGAAGCAGCATCATAGTGCGGTGGGTGTGGACTCCGACGAGGCGACAGAGGAAGAGGATGATGACGTGCAGCACGAGCGGCAGC
GTGTGGAGCACGAGCCTCCTCAGCCGAACGACCTCGTCTTCATCCGGAACTTGCGCCAGCAGTACGCCGGCAAGCCTCGGGCCAAGGTCGCGTTGAAGGA
TTTGTGTCTGTCCATCAAGAGCGGCGAGTGCTTCGGCTACTTGGGTATTAACGGCGCCGGCAAGTCGACAACGATGGCTGTGCTGACGGGACAACTGGCG
CCCACGCAGGGCTTCGTGACTCTGAGCGGCTTCGACCTGTCAACCAGTTCGGCTGCAGCACGGAAGACCATGGGCTACTGTCCGCAGTTCGACGCGCTGC
ACGACCTGCTGACTGTGAAGGAGCAACTGCAGCTGTACGCCCGGATCAAGGGCATCCCCGAGGCTTTCGTGAACACCGCAGTGGAGGAGCAGATTCAGGA
GTTGGGCCTCACGAAGTACCGCGACAAGCTCACGCGGGGTCTTAGTGGCGGCAACAAGCGCAAGGTTTCGACGGCCATCGCATTGTTGGGCCGTCCTCGT
GTCGTATTCCTTGATGAACCATCGACAGGCGTGGACCCAAGCTCACGACGGAAGATGTGGGACGTTATCGCGCGTGTGTGTTCTACCGATCGGGAAGGAG
ATCGCGGCGGTGGAGCTTGTGTGGTGCTCACTACCCACTCGATGGAGGAGTGCGAGGCGCTGTGCTCTCGGGTGGGCATTCTCGTGAGTGGCCGGTTGAA
ATGCCTTGGCAGCGTCGAGCACCTGAAGCAGAAGTTTGGTCGAGGATTCACGGTGGAGATCACGCTACGTGCGGCTTCAACTAATCCAGATGATGCGGAG
CTGACTGCTATTATGGACCAAATGGTGGCCTTCCTCTCAGCCGAGAGGAGTCTCTCAGCGCATCGAAACAGCCGAACCAGCCAGCGCCAGAGCCTGACTC
AGGGAGCAAAGATCACAAGCGCCAACATCCAAGACTTGTGCACGGCGCTAGGCTCGTCTGAACGCGGCTCTCGCATTTTGGACCACTCGGGCACTGGCTG
GTTGCTCAGCAGTCAGCTTGAAGCTCAGGGTGCGATCTCGGTCGACAGTTTCTGCTCGTGGTGGGTCTCGGAGACGCACAGCGAGCGGCTGCAGAGCTTC
TTCCACGACACGTTCCCGGGCAGCGTCCTCGCGGAGCAGCAGGGCGAGCACTTCCGCTTCCAAGTGCCCAAGCATCGACCAAGTAGCGACGCACTGCTGC
GTCCGGCCGAAATATTCCGTGCGCTCGAACATACGCGCGCGGATTTGAACGTGGACGAGTACAGCGTGAGTGAGACGGCGCTGGAACACATTTTCAATAA
CATGGCAGCGCAGCAGGACGAGGAGAAGGGCGTCGCGCACGGAATGCACATGGAGTAAGCACAGTTAGTGTGTGCATGAATGAATAATGCGCTATATAAA
GTAATATATTAACATCAGCTGATAGAAAACGTGCAAAACTAGGTCGTCTTCGACTTGGCTGGGAACACCTTTAATATAAAACGCTGGTGCCGCGCCGCAG
TTCACTTTCTGAAGCTGGTGCACGGGGCTGTTGATGTCGATGTGCATTTCCTGCCTCAGTCTGTCTTGCTGCAACTTTGAACCTGCTCGGTCGACATTCT
TCTGGCTCGTGTAGCACGAAGGTTGCGCCAGGTTACGCTTACGCGTCCAATTAATCCGTCCACCCCCTCATTCTTCGGGTGCTCCCAGTATAATGTGCCT
TCTGCAGCAGAATCCGCAGCTAGACTACAATTCGGGCTGCTATCCCAGTATTAAAAGTGACTAAGTTTAATTAACATTTGCGCCCCGTGGTGACTACTGT
AGCAGCCTCAAATATATACCACCTCGGGCACGCAGTTTAGCGCTAGGAGCCCTGTCTTCGATGATAGAACGTCGCCTTCCGCAGGGCCATCAGCGCCGAC
GGGCACGTCGGACGAGTTCAAAGAGCTGTTGAGGAGAGGGGCAACCCCAAGTCTGTCAAGGTGTTCCGCGGTGAGGCCCGCGACATCCTACACGACATCT
TCTTCGTGCTGCTGCTGCGCTCCAGTGGAGGAAGGTCCTTGCGACTCCATTTGAATTGTATTCAAACCTGTCAGCCAATACAGAACGGTCCACGAAGACA
GTAATGTAATCAGTTTGGCCACAGTTGAGTCACAATCATACTGTCGTTCTCTTGATAAACGGGCTCTCGTTAAAGCAACTTGGGTTTGGGCACCTTCAGC
AACTTCGTGCAACTTCGGGCACCTTGGTCGAAAAAAGTTGCCCAAAGGTGCGCAACTTCGTGCACCTTTGCGCACCTTTGAGCACCTTCGTTTGAGCAAC
TTCGTGCAACTTCAAGCACCTTCAGCACCTTTGGGCAACTTCGACGAAACCCGAACATTTGCAATACTGAATTTTTGCACTAGCGAGTAGGCTCTGCAAC
TTCAACAGCAACTACATGCACCATTCAGCAGAGTGCGTTCACGCTGCCTGTACTGCTAGGCAAGCTGTTGAATAAAGGACACTAAATTATATAGGGGGCG
GAGTGAACATCTTTTACTTCGACCTGAGCCAACACAGCTCAGTTCAGTCCAGGTAACCCTTTCAA