Description :
From Genome Similarity Track
Location :
Scaffold_21:75865- 79565
Transcript NameFunction/comments
Phyke_g1369hypothetical protein PHYSODRAFT_321823
Phyke_g1370hypothetical protein PHYSODRAFT_343735
Phyke_g1371U4/U6 small nuclear ribonucleoprotein Prp31

Sequence
3700 bases(100 bases per row)
ACCACAACTTGAAAAGCATTCGCAGCCGCTCCACGCTTCACAGTAAGATAGAACACTGCATCATTATTCTGTTGTTCATATTGTACGAATCGATATCGCC
CCACATCATCCGTCATAACACCGTCCAACGGACTGAGCTGCAACAAGTCTCGAACTCTTTCCAACGCCACCGTCTCAGATTTGGCCGACATCTCAGACGC
TGCATTATCTCCCTCTCCCCTCACAACTTCAAACACTCCTTGCTGGAAGAAAAGCACACGGAATGCGTAGCGTTTGCTGAGTGGTTGGTGTGTACCAGGA
CTGGCAAACGTGAGCTCAATGACGCCACAAACTGGTGCGACAGCGTCCCGTAGTGGCGCTCGCAATTCGTGCCTTTCTCCAACTCCAAATGACTCCAGAG
TCGTGGAAAAGAAGCTCGTCTCTGCGTCCCGAAGCTTCACATTGACAGTCACCTGCACCAACTGTATCTGCGAGAGGTTCTCCACTGAGATTAATAGCTG
GGGGTCGTCCCCATTGGAGGCGTACGTGGACGACACGATCAGGTTCTgaagcagcgccacctccATGACGTCGTTCATCATTTGCATCATCTGTGCACTC
TGCGACAAACTCTGTCCCACACGCTCGAATACCGACGCGAACGATTGCTGCAACCCGCCCGCATAGCTCTCTAGCATGGACGCCATCTCATCCATCGTGA
CCAGGTTTGACAATGAACTGCAAACGTAAAAGTCGAATGATGTGATCTTTCTATTACACGAATACTAATTTTTGTATGAGAACTGAGTTTTAATGCAAGC
TCACATCAAGACATGTAAGGGAGCACTTCTTGCCAATGTAATGTTGTTAGTATATTTCTAGTCAACCAACTCATCCTTCGTTGCAATAAATTACGTGGTC
TAATGATGAGGAAGTCGCCTGGCATTCTACTACGGACGGAGTACTGTCGACGACACTCAGCTCAGCTAGAGTCGCTGCGCTAGTCATCGAAAACGTTCCG
TCCTTTGCAGCGGAGGAAGCTGCGATCTCGGTCcaagcaacttgctgcttaACGACGGCCGTAGCCACGGTTACCGCCGCCACCGCGACCACCGCGGCCA
CCGCGACCGCCGCCGCCGTTATCGCGAGCGTATGGCGAGGGCACGATACCAGGCACGTTCAAGAGATTCATCTTCTGAAGCGttctcttctccagcttgg
GCACCTCGTTCAGACCGATTACGCGACTGTACTCGGCCgcaagctgcacaagcaccTCGCTCTTGATCTTTAGGCGCTTGGTATGCGAGTTGTAGAAGCC
GAGCCACGCCTGGTACGACTGCTGGGCCGACTTCTCCAGTtcgctgtgcttgtgcagACTCTCGATAACCTTCAGTGCGCGCGACTCGGAGGGCACCAGA
TCCTTCGGCGAATGATTCTTACTAGCCTCCAGCGGCAGATCCGACAAGGTGTTCAGCATCGGAGCCTCAAACTCAGCCAAAATGAGAACTCCCTTACCCT
TCATACCTGCGCGAGCGGTACGTCCAAGGCGGTGAATGTACTGGTCGCGGTCAGTTAAACCAACTTGCAGAACAAGTGACACATCCGGGTAATCCACACC
ACGAGCAGACACGTCCGATGAAAACATCACAACCTTCTTACCCTTACGGAACGCATCCGCCGTCTTCGTGCGCATGGCCTGGCTCTTACGAGAGTGCATC
TCCAAGACCCCAGGGAAACCAGCAGCCTGGAAAAGTTGCGCCATGAACTGTGCCGAACGAGCAGTCGGGaggaacagcatcaccttGTATGCTGGCAGTT
TCATGTGCTCAACTAGCACACGCTCCACCATCGGTACAATGCCCTCCATCTCTACCACCACGTACTTCTGCTCAGTCTGCACGTTCGTGTCAGCCTCGTT
CTCGTCAATGGTATCCACGAACGCGTAGTCGGAGCGAAGAGCCACACtcttcagctcctccgtGGAAGCCGGCAGCGTAGCACTGAACAGCAGTGTCTGA
CGTTCCCTCGGCAGGTACCCCATAATCCGCATAATATCCGGGCGGAATCCCATATCCAGCAGACggtcagcttcatccagaatCAGCACGCTCGACTGGC
CTAACCGGTTCGCAATGCTACCGGTGTTTGACTTCAAATGGTCCACCAGACGTCCTGGAGTCGCAATCAAAATGTCGACCGGCGTGGGGCTCGAGAGGAT
GTTCGCATCCTTCTTAATATTGGCGCCACCGACAAAGCAGGCAACCTTAACATCATGGAATTTGGTCAGCCGCTGGGCTTCCGTAGCGATCTGCTGCGCC
AATTCACGTGTGGGAGAGATGACGAGCGTGGGGATCACTCCCTTACGACGTCccttctccaccatgttcTCAATCACCGGCAGCAAGAAGGCGATCGTCT
TACCGTTGCCCGTCTTGGCCTTTGCCAACACGTCTTTTCCCTCACGAATGAATGAGAACGTCTCGTTCTGGACGTTCGTCAGGCGCTCGTACTTGAGGTC
CTCCACAATGGCgcgcttggtcttgtcaGAGATGTCCAGGGACGAGAACAGTACGTCAGAGAGGTAGTCGAGGTTTGTAGCGGTGGTGGGAGTAtctgca
acaacaggatcagaaagaggagaaaaagtttcttcttccttaGCGggagcttctccattggAGACCTCCGTgttcttgttggtgttgttaCGACGACCGC
CACGACGAGcgcgtttcttcttctgttcaCCTTCGACCTTCTCGCTACGGGGGCCTCCCGCTTGCTTGCGACgccagttgttgctgttgctgttgctgtt
gtcttggGGCGCCATCTTGTACTTCTGAAGTTCTTGGGGCAGAGGTAGCCAAAACGAAAGTGACGTCAAACAAACACAAAGGACGTCTCTCACCCAACCA
AAAGACACGACCGTTTCTTTCTTTAGATCGGTCCAAATTATTTGAGGCAATCTTCAAAAGGATTCGAAGGGTCTGTCCCGTTTTTATTAAATTTTGTTTT
GTTAAAAATGACAATCACTCTTACAATCGGCACAAGAACACGAGGCATCATGTCGACGCTCGCAGACTCGTTCTTAGAGGACCTGGACGAGCTCAGTGGG
GgaagcagcgatgacgaggagacGTTGGGCGTCTCCTCTACAACCGGCACTGCAACTACTGCCGACGCAGACACAAGAGACaacgatgaggaagatgaac
agATGCCCGAAGCAAACTCTGACCAGTATGCAGCCTCCAGACCAACCAAACGGAAGCGTGTGAACGTAGAACAGGAGTTCACGGCGGAAAAGACCGAAGA
TCTGGTGGAGACGCTTCGCTCCAGCGTCAAGAAGCGCGGTGTAGCAGCAGTTGCGTCGCTCAAGCGCTCGTCCAAGTACTTGGAACATGTGCAAACAATC
CAGCAGTatgtggatgtggacgacgCTGCAGGGGCGACTTCAGCCAAATCGCAGCAGCTAGAAGAAGGCAGTGCAGAGTATGATCTGGTGGTGACGTCCA
ATGACCTCATGGTGCAGATtgacgacgagatcgaggCTGTACACCGCTTCATTGCTGAGATCTATGCAGCCAAGTTCCCGGAGCTGGATTCCCTTGTGCC
TAATGGTTTGGACTATGCACGTGTGGTGAAAACAATTGGCAATGAAATGGATCTGTCACTGGTGACTGAACTACCCAAATTGCTGCCGAGCTCGGCGGTG