Description :
From Genome Similarity Track
Location :
Scaffold_21:75847- 87645
Transcript NameFunction/comments
Phyke_g1369hypothetical protein PHYSODRAFT_321823
Phyke_g1370hypothetical protein PHYSODRAFT_343735
Phyke_g1371U4/U6 small nuclear ribonucleoprotein Prp31
Phyke_g1372hypothetical protein

Sequence
11798 bases(100 bases per row)
CTGCTTCCAGCGGCAGACACCACAACTTGAAAAGCATTCGCAGCCGCTCCACGCTTCACAGTAAGATAGAACACTGCATCATTATTCTGTTGTTCATATT
GTACGAATCGATATCGCCCCACATCATCCGTCATAACACCGTCCAACGGACTGAGCTGCAACAAGTCTCGAACTCTTTCCAACGCCACCGTCTCAGATTT
GGCCGACATCTCAGACGCTGCATTATCTCCCTCTCCCCTCACAACTTCAAACACTCCTTGCTGGAAGAAAAGCACACGGAATGCGTAGCGTTTGCTGAGT
GGTTGGTGTGTACCAGGACTGGCAAACGTGAGCTCAATGACGCCACAAACTGGTGCGACAGCGTCCCGTAGTGGCGCTCGCAATTCGTGCCTTTCTCCAA
CTCCAAATGACTCCAGAGTCGTGGAAAAGAAGCTCGTCTCTGCGTCCCGAAGCTTCACATTGACAGTCACCTGCACCAACTGTATCTGCGAGAGGTTCTC
CACTGAGATTAATAGCTGGGGGTCGTCCCCATTGGAGGCGTACGTGGACGACACGATCAGGTTCTgaagcagcgccacctccATGACGTCGTTCATCATT
TGCATCATCTGTGCACTCTGCGACAAACTCTGTCCCACACGCTCGAATACCGACGCGAACGATTGCTGCAACCCGCCCGCATAGCTCTCTAGCATGGACG
CCATCTCATCCATCGTGACCAGGTTTGACAATGAACTGCAAACGTAAAAGTCGAATGATGTGATCTTTCTATTACACGAATACTAATTTTTGTATGAGAA
CTGAGTTTTAATGCAAGCTCACATCAAGACATGTAAGGGAGCACTTCTTGCCAATGTAATGTTGTTAGTATATTTCTAGTCAACCAACTCATCCTTCGTT
GCAATAAATTACGTGGTCTAATGATGAGGAAGTCGCCTGGCATTCTACTACGGACGGAGTACTGTCGACGACACTCAGCTCAGCTAGAGTCGCTGCGCTA
GTCATCGAAAACGTTCCGTCCTTTGCAGCGGAGGAAGCTGCGATCTCGGTCcaagcaacttgctgcttaACGACGGCCGTAGCCACGGTTACCGCCGCCA
CCGCGACCACCGCGGCCACCGCGACCGCCGCCGCCGTTATCGCGAGCGTATGGCGAGGGCACGATACCAGGCACGTTCAAGAGATTCATCTTCTGAAGCG
ttctcttctccagcttggGCACCTCGTTCAGACCGATTACGCGACTGTACTCGGCCgcaagctgcacaagcaccTCGCTCTTGATCTTTAGGCGCTTGGT
ATGCGAGTTGTAGAAGCCGAGCCACGCCTGGTACGACTGCTGGGCCGACTTCTCCAGTtcgctgtgcttgtgcagACTCTCGATAACCTTCAGTGCGCGC
GACTCGGAGGGCACCAGATCCTTCGGCGAATGATTCTTACTAGCCTCCAGCGGCAGATCCGACAAGGTGTTCAGCATCGGAGCCTCAAACTCAGCCAAAA
TGAGAACTCCCTTACCCTTCATACCTGCGCGAGCGGTACGTCCAAGGCGGTGAATGTACTGGTCGCGGTCAGTTAAACCAACTTGCAGAACAAGTGACAC
ATCCGGGTAATCCACACCACGAGCAGACACGTCCGATGAAAACATCACAACCTTCTTACCCTTACGGAACGCATCCGCCGTCTTCGTGCGCATGGCCTGG
CTCTTACGAGAGTGCATCTCCAAGACCCCAGGGAAACCAGCAGCCTGGAAAAGTTGCGCCATGAACTGTGCCGAACGAGCAGTCGGGaggaacagcatca
ccttGTATGCTGGCAGTTTCATGTGCTCAACTAGCACACGCTCCACCATCGGTACAATGCCCTCCATCTCTACCACCACGTACTTCTGCTCAGTCTGCAC
GTTCGTGTCAGCCTCGTTCTCGTCAATGGTATCCACGAACGCGTAGTCGGAGCGAAGAGCCACACtcttcagctcctccgtGGAAGCCGGCAGCGTAGCA
CTGAACAGCAGTGTCTGACGTTCCCTCGGCAGGTACCCCATAATCCGCATAATATCCGGGCGGAATCCCATATCCAGCAGACggtcagcttcatccagaa
tCAGCACGCTCGACTGGCCTAACCGGTTCGCAATGCTACCGGTGTTTGACTTCAAATGGTCCACCAGACGTCCTGGAGTCGCAATCAAAATGTCGACCGG
CGTGGGGCTCGAGAGGATGTTCGCATCCTTCTTAATATTGGCGCCACCGACAAAGCAGGCAACCTTAACATCATGGAATTTGGTCAGCCGCTGGGCTTCC
GTAGCGATCTGCTGCGCCAATTCACGTGTGGGAGAGATGACGAGCGTGGGGATCACTCCCTTACGACGTCccttctccaccatgttcTCAATCACCGGCA
GCAAGAAGGCGATCGTCTTACCGTTGCCCGTCTTGGCCTTTGCCAACACGTCTTTTCCCTCACGAATGAATGAGAACGTCTCGTTCTGGACGTTCGTCAG
GCGCTCGTACTTGAGGTCCTCCACAATGGCgcgcttggtcttgtcaGAGATGTCCAGGGACGAGAACAGTACGTCAGAGAGGTAGTCGAGGTTTGTAGCG
GTGGTGGGAGTAtctgcaacaacaggatcagaaagaggagaaaaagtttcttcttccttaGCGggagcttctccattggAGACCTCCGTgttcttgttgg
tgttgttaCGACGACCGCCACGACGAGcgcgtttcttcttctgttcaCCTTCGACCTTCTCGCTACGGGGGCCTCCCGCTTGCTTGCGACgccagttgtt
gctgttgctgttgctgttgtcttggGGCGCCATCTTGTACTTCTGAAGTTCTTGGGGCAGAGGTAGCCAAAACGAAAGTGACGTCAAACAAACACAAAGG
ACGTCTCTCACCCAACCAAAAGACACGACCGTTTCTTTCTTTAGATCGGTCCAAATTATTTGAGGCAATCTTCAAAAGGATTCGAAGGGTCTGTCCCGTT
TTTATTAAATTTTGTTTTGTTAAAAATGACAATCACTCTTACAATCGGCACAAGAACACGAGGCATCATGTCGACGCTCGCAGACTCGTTCTTAGAGGAC
CTGGACGAGCTCAGTGGGGgaagcagcgatgacgaggagacGTTGGGCGTCTCCTCTACAACCGGCACTGCAACTACTGCCGACGCAGACACAAGAGACa
acgatgaggaagatgaacagATGCCCGAAGCAAACTCTGACCAGTATGCAGCCTCCAGACCAACCAAACGGAAGCGTGTGAACGTAGAACAGGAGTTCAC
GGCGGAAAAGACCGAAGATCTGGTGGAGACGCTTCGCTCCAGCGTCAAGAAGCGCGGTGTAGCAGCAGTTGCGTCGCTCAAGCGCTCGTCCAAGTACTTG
GAACATGTGCAAACAATCCAGCAGTatgtggatgtggacgacgCTGCAGGGGCGACTTCAGCCAAATCGCAGCAGCTAGAAGAAGGCAGTGCAGAGTATG
ATCTGGTGGTGACGTCCAATGACCTCATGGTGCAGATtgacgacgagatcgaggCTGTACACCGCTTCATTGCTGAGATCTATGCAGCCAAGTTCCCGGA
GCTGGATTCCCTTGTGCCTAATGGTTTGGACTATGCACGTGTGGTGAAAACAATTGGCAATGAAATGGATCTGTCACTGGTGACTGAACTACCCAAATTG
CTGCCGAGCTCGGCGGTGATTGGTATCTCCGTGACAGGATCAGGAACGAGTGGCAAACCGTTGGGTCAGGAAGACTTGAACACGTGTATGGAAGCTTGTG
ATGAACTTTTGTCGCTGAATAAAGACAAAAACATGATCTTGCGTTTTGTGGAGAGCCGAATGAAGTATCTGGCGCCAAACGCCTCGCAGCTTGTGGGCAC
TCGGATTGCCGCACAGCTTATCGGACTTGCTGGCGGTGTGGCGCAACTCGCACGCATTCCGTCCTGCAATCTGCAGGTGCTAGGTCAGGAAAAGAAAGTT
TTAAGTGGGTTCTCGTCGGCCGCTGCTCTTAAACACACAGGGGTTCTGTTTTTCAGCGACCTCGTGCAAAGTGTGCCGCCTTATTTGCGGATGAAGGCAT
GCAGAGCAGTAGCCGGCAAGTTGGCGTTAATGGCACGTGTCGACAGTCAGCCGCATCAGGACGACACGGAAGGTCTTGTGGGTGCGCGCTTCCGTACTGA
GCTCGTAGGTaagatggagaagtggcAAGAGCCACAGAAGGCGAAGACTAAGAAGGCACTGCCTATCCCCGACGAGAAGCCGCGGCGCAAACGTGGCGGT
AAGCGTTATCGTAAGATGAAGGAGCGTATGGAGATGACAGATGTGCGGCGTGAAATCAACCGACAATCCTTTGCGACTGCCGACGAGGAATACGGTGATA
ACGCAATGGGCATTACTTCCGGGCGgcttggccaagaaggatCAGGCAAACTTCGTATTATGCGgaaggagcagaagcaatcAAGCAAGAAACTGCGGGC
TGCGAACTTCGCTGCTAACGGTAAACCACCACTTTCCGGTTTGGCTTCCAGCCTAGCATTTACACCTGTGCAAGGTATCGAGCTCATGAACCCCGAAGCC
GCGAAGGCTCGCGTTGCTGAGGCCAACAAAAAGTATTTTTCGGCGGCTAGCGGCTTCGTTAGCGTCGTCAAGAAGCCATGATTCTGGCCAAGCAATATGA
TTGGCAAGAAGATGTGGGTGGGGGTTGCAAGTGCTGGGAGTGCTGGGAACAGTGGGGCGAGTAATATTGCGAGTGAAAGAGTTAAGCGAGACGAACGGCT
AAACAATGAACATCATGTCTTACTGATCCAAGTTTCCTTATTTTACTTGGTTCGTATTCTGATGGAGTGACGTCATCATGGAGGCTACACCGTGACCGTG
TCCGTCAATTCGGCCCCGTGAATCTCAAATGTCATGATCGGTACCGTGGGAAAGTCAGCACTGAACCTTGTGCTCTGACCAATGAAAATGTTGTAACTTG
AGATGTTGTATTGCACACCAGTGTCAATAGTATTTGGGATTGGCCGTACCGATCCAGTTATCTCCGGGGTTAGATTGCATGATCCCCACCACCCCACTGC
CGGCACACAAAAGCTGCGAGTTTCATTTCGTTGATGTCCCTGACGATGTTCTCGGCCATAGTTAGCCCTGTGgtatcttcatcagcatATTGGAAATCCC
AGGTCGgcctcttcttgctcgtaAGTACTTCGAACTTGTCGCGCTCCATGCCGGTGTACGGGGTCAGACTATCAGAACCATGCGCATTGAACTTTCCGAT
GCTATCAACACCGGGGAGCACGTCTGCTATCACCGTTGTGAGCGTGAATAGCGACTCCCCCGGATTCTTTTGCTCAGCACCTGAAATCAGCACATCTTGC
AGACCGAGCAtgtcgagctgcttgcgtAAGAGCGTCAACATGTCGCTTTGCGTCGCAATCGAGAAATGGCAAGCCTCCTGTGGTTCTGGAAATTTCCAAG
CCTTGCTATTAGCCTCATTGAACAGCGACGCGTAAGCGAAGTTGATACCCCAgttctccttggcctcgttCACGACCGTGGCCAAGTACAGAGCGAAGTG
CTTTTTGTACGAAGCCTACAAGTTGTCTGCCTCACCATCGTtcccagcagcagtagcaagaTTATTGGTCATCCACCACGGAGGAGAATTCGAATATTCC
TCTAGCACATTCGCACCGCGATCCGATGCCAATTTAAGCATAGCCCGTTGTTTGGCGTCAGCAGACCAGTTCCAGCTTGTCGATGTCGGATCTTTGTTGA
TCCAGTCCAGCCGGAATGCCTCGATTGCCTTGAACGTAGGCAGGATGCATCTTCAACGATAACGTCGGATCCACGTTAAGCTTACATGTATTCTCATTGT
GAGCTGTGAGCAGTAGATTTTCTTTTACCTGAAATCTTACGATCGGCCTCATTTGACCGGCTTGATTAGATCGGCTAAGGTTCACTCACGTTACAACACT
GTATGGTTCTCTGGCTTTCATCAAGCCTTGACTCGATGTCCATGTACATAGACGGTAATCTGTTGTACTCTAGAATACGAATGTGCTTTAGCTCAGGCGT
CGTTGCCTACTGTACCCGATTAAGTCAGTCTAGTCCGCACTTAAAGGAAGTACTCCTCATATTTTTGCTCGTAGATGATGCAGAACCGCCGGTCTGGGGT
TCGACGAACACGGTGCAGCGTGCCAGGAATACGTCCTTCCGTGGCGCGCGCCAGCGCCTTGCCGCAGAACAACACAATCTCCTTGCCAGGGACACACACC
TTCTCAGCCTTCAGCCATTGCTTGGAGTGAGGGTCGTACACATCCAGTCCCTCCACGCTGGGAACAGGTTCCACAACATAGAGACTTGGGTCCACGTGCT
CGAACACATTCTCAGTCTCAGACTGTCCGCTGCCCTGAATATTTGGGTAGTGCAATCCATAGCAAACTGAGAAATTCTCATCCGAGCGCGCGTGACTCGG
CGCAATCTCATACCCCACAGTTAGACTCAGCGCACGATCGCAGATTTTCTCCATGCGGCGCTGCAGTGACAACCAGTGATCCTTGAACTCTGGTGACGGC
CAAACCAGACGTGACATATCGCCACAAGCAACCCGGAAGCAGTCGCGAACACTTGTGTGTTCGTATCCACAGTACCACATTGGGGTCTTGTTCTCATTGC
GGTAGATCTGCTTGCTGATGCATTCGTTCTTCCagtcgtcatcgtcactcgTGAAAAATGTGTCAAAGTCCTGTAGCACTTGGTCGTGAACACGTTCCAG
AGACTCCCCAAGGTCTGTTAGTACTACGAACGAGTGACactccatcatctccaagaACCGGGAGCGATTCTTCCAGTTAAGTTCACTGAGCTTCAGACGC
GGCACTTGCACTGCATTACCAGTAACTTGTACTTCCGAAGCCTTTTCGGTGGTTTTGCTGGGTTTCTGGGCCTTAGGGTGGGTAGGATTTGTAGCGGTGG
TTTCGGGAACTTCGCCGGTTGCATTCAGACAATAGTAACTTGCTCGTAGAGAGTAGTTGGTCGACATGAGGGGCTCTGCTAGGGTCGTCGTCGTACTCGT
CgtcatggtggtggtggggccAATGCACGAATGGTTTGGACGTTTTTTTACGGCATTAATAGAGGCCCCACGCTTATTTGACCAATCATAAGTCGTTATA
TACATTATAGACCAATCGATATGCAGGAGACCTGGTTCAACAAGTATCAACTGCTTTTCCTGTTTGTTCAGCGATGACTTGCTCGGTGTTGGTTGATGTA
CAAATATGACAATTTTATATGCTAATTTATGGCAGTGCTCGCGATGTTCGGCACACAGATCTACAGAATATAGAGGGTGTAGTAGGATCAGACACGAGCG
CGACTAGCGGCAGAGCTGGGGCGGCTTCGAACTGTGGTGGGCTTTGGCCTGGTTGAACCCGGCTGCTCCTTCGCGGCTGATGACCACCTTGGGTCGCTCT
GGAAGTCGAACAGACGCGACCGCACCTGGTCCAGACGGCCTTGTCGTTCTGGAGTTTGCGGTCTCCGTGTTGTCCTGCTGTTGAGctgcttggccttgtc
aGCTGCCATGTTGCGATTGCGCTCCTCCAGCTGACGCCGACGCTCAAGGTTCCTGGCCTTCGTAACCGCAAAGCGCGACGACTGATCATAGTCCATATAC
CTGGAAACTGGCGCCGAATCCGACCAATGCGTGCGTGGGGATGCGGTCATCATTGGCGGCGAACCGTGCGTCGATACGGAGAAACGTCGCGCGGACTTGC
TAGTCGGTGGCGTGCTCGTTGTTGAAAGTGAGGAACGGCGAGGTCTGGGGATCACTGACGGCGCTGGAGCGGCGGCCTTGGTGTACAGCGACGAGCGACG
TAGGTTGGTGGCCGCTGGAACTACCCCCTTGGAAGTTGTGGATGGTGATCTACTTGAGAGGGAGGATCGTCGATATAACGCAGGATGGGTTAACTTGGGT
GCCACAAGGGGCTTAGTTCTCTTGATGTTTTCGCTTGACGCTTGCAGTAGTTCAGGCAGGAACATATCTAGGGAACTCAACAAAGAGTCCAAAGATCCGG
TAGAGGCTGTGGAAAACGACGACGGACTGCGAGGCATAGCCGAGTAGCAATTCACGTAGCACATCGTCGACCCCACATAGCTCTCATCTTCGTAAGGGTT
CAAAGTTTTGATgttgtcctcgtcgtcactctcCAGAGTCTTGACTGTGAGTGTATTGTGCTTCACAACAGACTCAGGGGTCTTCTCCAATTTCTGAACA
GGTTCCGATTGGGTACGAGCTCGACTAATCTGGTTATCTACCGGTTTCTGAGGCGCCGTGGTGCTTGACTCCGCCCTCGTGCGTGAGGCATTGGACGCTG
CATTGGCCTGCGCCATGAGCTCGAACTTGTTGATTAGTGACTGTACGTTGGCAGACtcgctgaagcagcagtcgtcgatCATTTTCGATGCAGTATAGTA
ATAGTCAAAAGGCTAAACAGTTAATTGGTTTTGGTGTGAGCTCTCCGAGTGCAAAGCAGAACTGACACTGGGCGGAACGATGGCGAGCGAGCTCGACACT
GAGGCAGGTAGGCAGCACGTTACAGTTTCTAGAATGTTGTTTGCTGGCTCTTGCAGGCAGGTCCTCTGGCCCCCGCCGGCACCTTGCGCAGGTCGCAAAA
CGGCAGCTCGGCAGTCGCATGGCAACTTCTGAACTGATGGGCACGAAACGGCTGCACCGTTTCGATTTTCCACGAATGAAAGGGCAGGAATAATGATTTG
AACCAATAAAAGATCGCGACATTTAAACTGGATGGCGCGAAAACCAGATCGGGGGTCTGCTAGATACAGAGGACAAGGATGGCAGGCTCGCCGACGGTTC
CCAGCAGCGTAGATGGTATAAAATGGAGGCTGCAATGAGCTGATCATGGGGGAATTGCGGGAAAGGAAGATCTTGTGAAGATGGCATGGCCACGCTGTGG
GTCAAAGAGCCGTCGGCTTGGATAAATGTTCTGGACACATCTCAACTTGAAACTCAAGGGGTCAGTGAACCACTTGACACTGGCAGTGATGAACATCATA
TGCCGTGTGTAGAAATTCGATGTGTTCGTCGAGCGGCGGCCACTCGATCTCTATGCGATACGCCTGATTCCTATTTGAAGTGCACTGCAACGTGCTCCAG
GACAGGCTCAAGCGCCAAGCGGCACGGCAAAATGGCTGGATTGTCACATATATCGCGATCTTGAAACAATCCTTGAAGCGATCTTCAGGAGACAAAGTAC
GTCAGTCAAGACATGTTGCCTACAGTAAGGATGTATCCATTCCTCACGGTTTCCTCCGACCCGACTTAATAGGCATAGCGCAGTTGCACCGAACCCGGTG
CAGCAGACTTTGCGAGCTCTTCAACCAGACCTTCGTTGCAATGCAACTTGTATTCCTTCCTACATTGCAATATGCCGGCTACGTGTTGGACCTTACATCC
ATACGTGGCGACTGGTTCTTGCGGTGTTCTCTCTCCTTGCGGATTTGCTCCTGTACGAAACTGCCAAAGGATTCTGCTAGATCATCGATGCGCTTCTCAT
GTTCGTGCTTTTGCGCCGACAGTTCTCGCTCTAGCTGCAACACTTGATtctccatggacgagatcacAGTTGCCTTCTCCTTCAAGCTCGCGGCGCTCTC
CTCAGCTGCAGTCTTCGCGGAAGAAGTCAAGTCCTGCAGGCGTTCGTCAAAGGTTGTTTGCATCTGCACGAATCGAGcatcctgctcctccattCGTCgt
agctggagctggagcttctcTCCACAACGCGATTTCTcgctcgttgctgttgccaacTGAgtctgcttctcctgcaaaGCCTTGGACTGCGCCTCCAATT
CGAGCTGGAGCTCATTTTGTTTACCGTCGCTCGCTTGCTGGAGCGAAATGTTATCCTGACGTAGCTGGATGATAGTCTGCAAGTGTTTTTCGACCTCACG
CTCGAGATGTTGTCGTGACTTCTTTACTTCTGCCACCTGCGCCTCAACCGATCCAACCGAACGCTGTATGCGCTCTTGCACTTCAGCAtcccactgctgc
ttcagctctCCGATCATCTTCTCGTGGTCAATTTGAGACTGTAGAACCTTCGCTTGTAAGGCTTCGCACTTTTCCTTCAGTTCACGCACACTTCGCTCGC
TCGATTCTAGTTGTGTGGAGGTGTAGCTGAGTTGGGTTTGAACAGACCCAATGACCATATCGTGTTGTCGTTGCGCGGCACTTAAGCTGCTTTCGTGGTC
GGAAACCAGCTTGGCTTCCTTGCGGGCATACTCCTGTTGTAAATCTTGCAACAGCTTTTTCAGTTTTccaatctcttcttcttgagtcCTGAACAACACT
CGAGGCAGATCAAGACAACGTCGGTGAGGCAGCCGACACTTACAAGGCTCGCAAAATGTGGTTGTTCGCCTACCTTGCGGTGAGAGTGGTGCGATGTATT
TCGTTGTCAAGCGTATACTTAGCATCTTCCAGCTGTGAGATCTGCTTTTCCTTCTGATCCACTTCTTTACTGTGCAAACTCTCTAAGTGAGCCATCTTTT
CTCGCATCACGTTATTTTCACGCTCAAGAGCTGTGCGTGACGATCGATATTCCTCAAATTCCAGCTTTTTGCGATTCTCAAGCTCATCGAGTTGCATGCG
CAGTTCGTGAAGATCACGCTTTGCATCAATCTCGCGTTGCTGGTATCGACCTCGTTCTTCCTTGGCCATCTCGGCGTCCTTGCGGGCCTGTTGGAACTgt
gcctccagctcttcgGTCTTTTCAACCTGTCATTTAAAGTGTACATATGAGCTACCACCAGATCACTGCAGAATTTATCCACGACGCAGCCTACCAATTT
CTGTCGATCTCGTTTGCCTATGTTTATCTCCGTCTCgagctcttccttctctgctAGCACTTGCAGCAATAGCTGGTCATCTGCCGGTGACTTCACAGCG
TCATTGTTCGATTCACCGCCTTCGTCAGGTTGGCAGGATGCATCGACGGCCAGAGGTGGCTGCTTCCCTATAAACGCGCGGTTTCTTGAAAGCAACATCT
CGATCTCATCGACgtgcttcaagctgcaatTGTTGCCCATTAACTCCAACGACACCAGCGAATGGTTGGTTTGCAGCGCCTCACGGAACGCTAATACACC
TGGATTCCCGACCTCATTCCATCGTAAATCTAACTGACGCAGCGTGCGGTTGCGACGTAAAGCCTTGGCAAGTGCTTTGGCACCTTCTGGACCAATGTTG
TTGTTACGCAAGTCGAGCGTGACTAACCGAGTGTCAACTTCTAACGCGTCGGCCAGAGCGTCCACACCTTGATCTAGCAAACCAACATTGTTCCACTCCA
AACTAATAGACACGATATTATGGGAAGAGcgcagcaatgctgccagtGCCCGAGCAGCGCCAGCTTCGAAGCAGTTGCCACGCAAGTCGAGTCTTGTGGA
AACACTCGTAAGTCGCgccttctccacaatctccGCGAACTTGTCGTCCCCTAGATACGAATTGCTGAAGTCCAATACTGCATCGGAAGATTTGGATGAA
GGAGATAATGGTGTCGGGtgcacaagtgcagcagtCTCTCGCTTCGCTTGGATCGTCATTTTCGTTACGCCTTTTCACGCACAAAAGATTTgagcgcttc
aacttgaacgCGAATCAACGACAGCTCTGACCATGTGGTAGGTATGAATACGGATCCACCAGGGTGGTCGATTGGGGTTTGCACCCAGCAGATGAGCA