Description :
From Genome Similarity Track
Location :
scaffold_16:7584- 9998
Sequence
2414 bases(100 bases per row)
TCCTTCTCTACGTTTAAGGTAGAAAGAGACATCGCCCATTTTGGAAGCAGGTACTCTAGGATGAATACCATAGTTCACATGAAATGGCGAATGACCTGTC
GAGAGATGCGTGGAGTTGTTCAACgtaaattttgcaaaagaagaaaattcaGTTCACTCTTTGAGAGACGTAGTGTGACTACGCGGTACGTCGACTCACA
CGCTCTGTTTGACCGTCCGTTTCAGGGTGGCATGGACAAATTAGTGCCCATTAATCCAAATAGTGCACGCCAGAAGTTCGACGTCAAACGGGTATCACGG
TCAGACACGATCTCAACAGGAAGGGTCTACAAAGATCTAAGCTGTCTTCTCGGTAGAGATCTTGTCCGAAACAGGCGCAAGATGAATCCTCTTGCTAAAT
CGGTCCAAAACACAAAGATGCCACTGCGTCTATGTGTGTCACGCGGGAGTCCGAGTATATAGTTCGTACTCGCAGACTTTCAGCTTTCGGTTGGCGACCG
AAGTGAAGCCTGAGTGGAACCTGATGGTCTCACTCTCTAGCGAATCTCTAGTTTTCACATTCTTGCGTACCCAATTACACATGTGCGGCCAGTAGTAATC
CTAGAAAAGACCGACAAACGTTGGCTCACATCCGAGTTGGCCACCCGTAGGGCTGTCATGGTACTTATACAAAAGACGATGACGCAAACATTCGTCATTT
GGAACAACATTTCTTGCTGTATCCCCGTGTCCTACCGCATCGTACAACAATCCGTTAAGTACTCCAATATGATGATCACACGATATCGTGCGAGACGGAA
GACCTTGAAGTGATTTGTTGGAAGGGTCATTGAAATACCGCAACAAGTCTTGACATGTCTTATTAGACTTGTACCCTTCGGCAATTTCTTCGCGCACTGT
AGTTGTAGCTTGCACTCCGATCGTCTGATCGCATTGTTGACATAACTCGTGCATTTTTTCTCCTGAACTTTGGACCATAGTCAGGCCTTcttgacaatgc
atcagctaAGATGTTCGTCTTGCCTGGCTTGTAGTATACAGCAAAGTTATACTccgcaaagaaaaaaattcatTGAGCTATTTTTTGCGATAAATGATAA
GTCTATACTGCTGTTAGAATcgaggcatgatctgtataaatCGCAAAGCGTTCATCTACAAGCAAGTACACACGGAAATTAAActaagcatacttcattg
ctagaagatctttgtcatgaactggatagTTCCGTTTCGCAGGCCGGAGATATTGCGGCTCATACGAAACAACTCGCTCTCGACCCTCATtatcgtgttg
catcaacgcacaaccgatggcaaagtcactCACATCGCAGACCACATGAAAAAGCTTATCGTGGTTTGCAAGGAGCTTCTCTCAGGCTCTctttcacttc
ggcaaactTCGGCAAATTTTGACCATTCCCACTCAAAGttcttctttaaaagaaTCGTTAGGGGTTGAACCAACACTGCATTATTGCgcgtgtatttgtg
caaataatTGGCCAAGCCCAACCATTGTCTCAGCTTGTTCACATTGCTTGGCACAGGCCAATCATTGATTGTATTGACTTTCTCCGGATCTAAACGAATG
ACATTCTTGCCCACAAAGCAGCCGAGAACGGGGATCTCTGTTGCAAAGAAAGTTCAAAATTTCAGATTAGCGTAGTTTATTCCCTCGCATAACTTGGAAG
ACCTGGCGAAAATGATCAAGGTGAACATCGACATAAGACTTCTCATCGGTTTTTTTATGAATGAGTATATCATCAAAGAAACTCGGCGCAAACTGTCTCA
ATGGAAGAAGGAAAGTTGTTACCATTTTGTTGAAAGTTGCGGAAACGCTCTTCAAATCTTGTTGCATCGATAACCATTTccacagcataccactgAGGGT
ACTGACTGCAGTTATTGGTGTATCACTTTTGCACATTCGTATCTGATAAAACCCATATTTTAGATCGAACGCACAGAGAATAGAAGTACCAACCATTCCA
TCAAGTATCATATCCTCGCATGAAACCGGAGTCTGGAAAGGTCTGGTTGCATCGCTTAATTTATtgaaagcgtgaacaatgcgCCAACCTCCTGTGGCTT
TCTTCACACAGAAGGTTGGACTACAACGCGAAGACTTATCCTCACACACATGACCAGCCTTCTGTTGCTGCGCAAAGAACTCGTCAAAGGCGATGACTTG
TTCTTTTGGCAACGGCCAATGCCGTGTAATACAATACTTCGTACCAGGAAGCATGTCAATCACATTTTTAATGCCTCTGTCAGATGGCATTTCTCCGGGC
ATCTTGTCTAGGAATAATCGGCATATTCCTTGACAAGTCCACACACGGAGTTCGAGTTTAGAGCGTCTCATGACTGCTCGTTTCCTTTCGTGTCTTCTCA
TCAAATACTTCCGC