Description :
From Genome Similarity Track
Location :
Scaffold_14:758385- 761291
Sequence
2906 bases(100 bases per row)
CATATCTAGAGAGCTGTACCAGAGTACTTTATCCAGATCTTCCAATAGCGCATTGATTAGAGGCATAAGATACACCATCAATCTGGTCACACCATTAACC
ATCCGGTAATCAATACACAGACGTACATCCACTCCCTTCTTCTTAACGATGATTACCACAGGAGATGCCCACGGGGAGGTTATAAAACTGATGATTTTGG
CTTGTGGCAGACCCTTGATCAGATCCGAGAGCTATTCTCGTAGCTGAGACGCCACCTTCCGCACCCTTTGAGCGATTGGCTTCGCATCATCGATATCGAT
GTCACATTTGACTCCGCGTGCAGCGGGTGGTAATGCGTTTCCTGGCAGATGTCGGGTTTCCCAGATCTTCTGACATAGCCGATCCACTTCCGCGGATTCG
TTCGCCCCCGGATCTACTTGGATATCATCAATCGTAATCTCCTCTGTGGTCAGTGGTACCTCCGGGATTACCGTCATACCTTCCCAAGATCCTCGGCGTG
TAGATCCCCGCATTCATGGTAGCAGACTTGTTTATCTTCAGTCTTTGTCGAATCCACCATTGGATCCAAGCACCGCGACCCTCTTTCACCCGTCATTCCT
TCTGTCTTCGTGGGATCAGGTACCCTGGTCACCTGTTGGATCGACTTGATCTTCTGGTGAGTTTATACACGACGGCTCCTGTTTAGCCAGGGACACTCTC
GACAGGGATCCGAGCATTCTATCCCATGGAAAGTTCGGATCAAACCCTGGGTCAGCAGGAATTGGCGAGCCGCCTTCAATTCCCGGCGACCCCTATCCAC
CGACCCTTGGATATCTAGGAATCGGCTCTGGGTTTCTCCAGCCGTCTTGGATCCAACTTCTACCACTTGGATCCCAATCTGACGATATCCATGCAGGATC
GTTCGCGGAGTTGGGTATGTAGGCCGATCCACCAAGGGGGCAGTTGGCTCCGCAGAAAGCCCCCCCCAGGGATTCAGTCTTGGTAGGCGCTTCATACGCC
ACATTCTGACATTCTTTATAGCGACGGGATCACACTGACACATATCCAAGTCACCTAGGGATACCATTCCTCGCCACCCACCGCCCGATCTCCTCATAGT
GGTCTAGTAATAGTCTCTTGTCGCTGACATTCGTGACGTGGTATAGTGATCGACCGGGTCCTTGGATTACTGTAGGCACCCACTTCTCACCCCGGGTGAC
CCACAGTTTCTCATGTTCCACCCATTTCAACCGATCTGGCAGCTCCCAGGTCTCTCTGGGCTCGATCCAGGTCGTCTTCTCCGCCCTTATGATCCTCATC
TCCGCTCCGTACAGCGGCCGCCTTCCACGGAGCTGGATCCGCATCTCGTCCGGGAAACACAGTATCCCATCTGCCAGATCCAACCTTACCCCAGCTGGTA
CCATGAAATCCATCCCGAGGATGGCATCTTAACCAGCGAGGTCCCCGACTAAAATATTAAACCAATATACCAAACAACCTGCCAGCGTGATCTTGATCCG
CGTTCTTCCACTCGTACGGTCCACGCCTTCACCAATCCCAACACAATCTTGAATCCGACTCCCATCTACTTGGCACCCAGCCTTACGAGCAAAGGCGGTA
TCTAGTACAGACACCTCGGCACCACTGACCAGGAGTAGGATTGCTTTTCCATTGTTGATCTTGCCTTCCACCTTAGCTTGTCTGAGCCATTTGCCGGGGG
CATGGTACTTCCAGTATCCACGGGACTCCCCTGTCAGCAGATTTATGGATCCAACATCTTCAGATCCACGGGATCCAGTCATCTGACAAACCTTGGGTGG
ATCTGCAGTGACCTCACCCTTGGTAGGCTCAAAACATTGGCCATGTTGTCGTTTCTCCCAGTATCCGCGCGCTTCTCCCCTTTGTAGATCCAGGGTTGAA
GAGACTTCAGATCCGGCGAATTCATCCACTTGGCGCAAACTAGAAACCTTGGCAACTGACACTTCATGTAGATCACGTGTATTATCGACTGAATCTAGGG
GCCTGCTACCTGGATCTAGCGATGGCTTGCTTACAAATACATAGATGCAATACCTAGAACGCTCGGCTCGTACCGGATTCAAACCCGGAAAGCGTCCTAG
TTTAACATCTTCTCTGCCACTTATGGCAACATCCCTCTGTGCTTGGCTGGATCAAACCATTGGCGGATCTGGTTGTAGAACTCTTCCATCGGGCACTTGC
CGGCGTCGTGGATCTCGCCACAGCCGCGACACACGTAGAAGCAATGATCCCCAGGACGACCTTTCTTGCCACACTTCTCACAAACCAGTATATTTCCAGC
AACCAGCTTCTGTGTGCTTCCGGGATCCACACTGCGATCACCTGGTTGTCCTGTTCCATCCGTGAGATCTCGGAATCTGTACATCCCACGGTCCCCGGGG
TACGGTATTACCAGTGCGAGAGTTGTCTCCCGTCTTCGCCGTACGATCGTTAGGCGCAGTGAGACAGACTCTGCAATAATTCTCTGGATCGGAGTCCGAG
CCATCGGATCTCGATTCAGTTACTGAGTCGGGCGCCGCTACTTGGTGGACACGTCGAGCTAGGGCCGTGGGTGTCGGAGCTTTTTGGCGATACTTGCCGG
ATCCGACCGCCGCCTTCTTCTGGCGATGTTTCGCGCGATCCACAGCCCGCAGCACTTCTTCAAGCTCATCTGTATCTGGTAGACGTAACAATGTCACCCT
GTCGGCCAGATACACATTTCTCAGTGTCTCGATGAAATGGTCCATAGTACCTTGGACCCTCCATCCTTGATCTTCAACTTGGCCCGTAGACCAGCCACAT
TTAGTCGATGTAGATATTCCAGCGGGGATTCATCCGATCTGCGGCGAGCGTGGTAGTATTGCCGTGCCACCGACACCCCCAATCCAGAGTACTGGGTTTG
GAAACT