Description :
From Genome Similarity Track
Location :
Scaffold_8:758246- 763557
Transcript NameFunction/comments
Phypa_INRA-310PPTG_05848hypothetical protein
Phypa_INRA-310PPTG_05849hypothetical protein
Phypa_INRA-310PPTG_05850hypothetical protein

Sequence
5311 bases(100 bases per row)
GTACGCAGAATGGCAGAACTTGGTGCTGCAAGCAACCACGGACGCGGTGAACGAAGAAAAGACATCGATCGTAGAGCCGGCAGGACCCATGGTCGATCAC
CCGCAGTACGATCCGCCGAAGAGCAATTTGAAACGCCCCGCGGCAGTCAGCAACCAGATCGCGAAGGTGTTTAACCAGAAGGAAGACGAGAATACGGCCG
AGGAGGTGTCCAAAGGCTACGCAACCGAAGGCCCGATTAAGACGAAGCCGATCAAGAGTGTCTAGAAGCTGCCCACGGTGAGTCAACCTTTGGAGGACAA
TCAGGTCTGCATCAGCGAAGGGGGCGAACACTTTGCGGAGGACGTGGACAGCCATATGGCGGTCCTGCCGGAGATAACGATGACCACGGGAGATGTGAAG
CTCCAAGATTTCCGAATCGAGAATGACGGCGAGAACACGCCGGAGGAAGTAGATCGCCTAAGGAAGATCATCTGGAGCCGACAACACCTGTTGCTTGGGA
AAGGAAACGCACTGCCACCCGCCGCGCGAGGCGTCGTCTGCAATATCGATACTGGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNGGCAGAACGGATGGTTCAGACTCTGACTAGAGCCCTGAAGATGTATGTCGCAGATATAAATCAGAAGGACTGGGGCGAGTTCG
CGGAACATCTGACGTTCGCCATCAACACGGCGTACGACCGTATTCGAGGCGACACGCCGTTCTATTTGGTCCATGGATGGGACGCTCGATCAACGTTAGA
AGCGACACTGCCGTTTGGGAGCACTCGCCGCCGGGACGTGGAACCACGTCGAACGTCCAGCGACAGTACCAGCAGACACGCAAGCTAGTCAACGAGGCGC
TGCGCGACGCGATCGAAGAAAGAGCAGATCAGCACAGCGAAGATGTGAGCTCGCATGACATAAAGGCAGGAGATCGAGTTTGGCTATTTCTAGATCGAGT
TAAGGAAGGTTACGCTTGCAAACTTGCGCATATGTGGCATGCGCCTTTCAGGGTCGCGGAAACAGTCGATCGACACGCAGTGCGTCTGGAGACCGCCGGC
ACAGAGTACCGACTATTTCCGATTGTCCATGTGTCAAAGCTGAAGCCGGTGAAGAGCTACCCAGAGCGCCCAACATCCACGCTGACGAACCGCGCCAGAG
CAGATCGAGTAGACTTCGACGAAGGCTTGCTGCCCGAAACCAGCTGGGAACGCGAGCTTGAAGAGGACGAGTACGAGATGGAACGGATTGCAGATGTGCG
CTCGAGCAACAAGACTCGATACGGCCGTACACGACGTGAATACCTGGTCTTCTGGTAGGGCTACGCCGAGCCGTCATGGGTCGATGAGACTGATCTCAAC
TGTGGAGCGTTGCTAAGAGACTTTGACCGGGGACGTACAGATCGTAACCGGTTTGAGGCGATGCAGTCACATGAGGAGTAAATGGTGGAAATTCTGCGGA
GGGTTGGCCACCGTGGAGAATTGAGAGGAAGAAGGATCTGCAGGAAGACGGCAGATTTCAAGGAGGATGGTGGTCCATATGGAGTGCCGTGAGCCTGAAT
AGGCCGGAAAATCTAGGCAATACACCCTCAAAAATTCCGGAAGAATAAGAGAAGATACGCATGGATTAAGTCGGTTTAGATCGGACGGAACCTTCTTGAC
GAGCGCTGAAACCTACGTGCCGCTAGCCAACACTTAACGGCAGGAAGAGGAGGACACAAACTTCCCAGACAAACGAGCGATCCCAAGCGCTGGATGGTCC
TTTGGCCCGTCGCGATAGTGGTTGCGCCAGCGATCGGCCGCATCGGTAATGGCCAACGTCTCCAGTAGATCTGCGGGGTCGGATCTGTCCTCGATCCCAG
GGTACCAGGCACCTGCTTCGCCAGGTCGAGGGAAATGCAGAAAAAAGGGATCCAGCAACAAGTCGAGGTCGCAGTAACCCAGGAGCAAGCCGATCAGCAC
CTGTTGAAGGAACGGTTTCCACCGGCCCCCTCCTCTGGATCAACGCTGCTTGCAATCAGTATAGAACGTATCCAAGTACCGACTGGCGCGGCGCTAGGCT
ATACTCACCGGAAAGGCGTGGGTAGAGTCCCAATAAGCCCGAAGTTGCTCATCCTCGTAAGAGCGTAAAGTCGCATCATGTCCCGGAACCAACCCCGACC
ATTGAACGTAAGAGGGTCCATCGGGGCGGCACGGATCTCCCACGAAACAAACTCGCGCACGTTGCTCTCGTCCACCAAATCGTCTCGCCATTCTCCAGGC
TGAGGTACGGGATCGCGGAGAGGGATTAGCCATTCCATCGGCTTGGTGAAGTGATGAAACAGCAGACCCGCGTCCATCTCCACGACGCTTGTCTAACGAA
TATCCTGCGCAGATCAGGGGACGGTATCACGACTGCGGTAGCTACGACGGTCCCGAAAACCGGGGATCCACTCCGATCGGGGAACCGTGGTAGGCGATAG
ATCCGCTAGCT