Description :
From Genome Similarity Track
Location :
Scaffold_33:75805- 77874
Transcript NameFunction/comments
Phyci_222006hypothetical protein PITG_02639
Phyci_273661Hypothetical protein

Sequence
2069 bases(100 bases per row)
CGATGGGAAAGTATTCGGCAGCGCTGCAAGACGCTGAGCAGGTTGTACTCCTGGACCCGAAGTCAACTGTAGTAAGTGCTCTATGAAATTACTGGTGTTT
ATGTACGTACATGACCTCATGAGATTGGGTTGGTACTGTGTGTTGCAGGGGTATTATCGCAAAGGTTGTGCATTGTGTGGACTTGGCAGATTTGCTGAGG
CAAGTCGGGCTTTTCAACAGGGGCTAGCGTTCGACGTTAATTGCCGATACCTCCATCATGGGCTTCAGTTAGCCCTCAGTTACTCGCGGTACATTTACGA
ACCGCAGTAGAAAAAAACGCGGTAGACATTGCTTTGATTGACATTTACAACACATTTTGCTTGCAGTTCGAGGATCTCACCCTCGAGCTCCAATCTGCAC
ATAAAGACTTGACTCCGCTGGGGTTGTAGCACTTAAGAAGACGATGTCCCAGTAGTTGACGAAGCAGTCTGTGTGGCGTCAGACAACCCTTGGTCTTCAG
CGCCGCTAGACTCTTGGGTCTCGATTCCCGACGAGGTGTCCGACGAAGCTGGCTGAGAACCTTCATCTTCAGTGCCGCTTTCCGTCCCCGATGCCTCGGT
CTCGGAGGAATCACCAGTTGGCGATGGCAGGGAGCCTTGCTCACCAGTGCCACTCGAACTGGGGGTTGTAGGCTCGGTAGGCTCGGTAGGTTCGGTAGGC
TCGGTAGGCTCGGTAGGCTCGGATCCTCCGGTCGGCATTTCTTGGGATCCCCGGAGACTGTAGCCTTCTCCTGGAGACTCCCCACCACTGCCTACACCAC
CACTTGGTGGCCCAAATCCTCCGTCGCTTGAACCACTGCACTCGACGCCCAATGTCGAGCCTTCACTTGGCGGCGTCCATCCCCCAGCATTTGAGCCACT
GCAGTCCACGCCCAAGGGTTCCCAGCCTTGACTTCCGCTGGGAGGAGCCCAACCTGCGCCCGATCCTGATGGCCATCCTGGTTGGTGTTGACCGTGACCC
CAGTACGCAGATCCTGACGGCCAGCCTCCACCTTCACCTCCCTTTCCCGGAGGGGCCCAGAATGTACCTGATCCTGACGGCCAGCCTCCACCTTCACCTC
CCTTTCCAGGAGGGGCCCAGAATGTACCTGACCCTGACGGCCAGCCTTGGCCGTGAGCTCCTTGACTCGGAGGTGTCCAGCCCGTGCCAGATCCCGACGG
TAGTTGGGGCCAGCCTTGGCCGTGAGCTCCTTGACTCGGAGGTGTCCAGCCTGCACCAGATCCCGACGGTAGTTGGGGCCAGCCTTGACCAGGAGTTCCC
TTCCCCGGCGGTGCCCAACCTGCGCCGGATCCTGACGGCCAGCCTTGACCTGATCCCTGCAGTTGGTGGGACCATCCCTGACCTTCACCTCCCTTGCCCG
GAGGTGCCCAGCCTGCAGCCGATCCTGGCACCTGGCCACCGGACGGGGGCATACCAAAGCCATTACTTCCGGAAGGCTGGTTGTTAACTGGATTTGGCAT
CACGGTCCCGTCCGTCTGCGCAGGACCATTCACGCTGTTGAAGTCAAAGGCGGAGGACGACGTGACGGCCAACGCGGCCACAAGAAGCGCTTGGGAGACT
GGGCTTGGCCTCATCCTTGAATATTTGAAAGTGACTCCACAGCTTTGCCTGCTCAATCTTCCCTCGTCGCTGCATTGTCAACATGTACAGCACCAGAAGA
GGCGTTTACGCTTCCCTACCGACCGTTCCAACGGTAGTGTGGTGTTGCTTGCATTGGTAAACGAGATTCTCCAGCCTTGCTTACGGCGACACAAAGCGCA
TGATAAATCTTGGATGTTGAAAATCTTGGATGATTGAACATGAAGGCCTTTACATCGAACGAACAGCAAAAATATTGAGTTGAATAGGAAGGTGCAACCA
GAAGGTCGTCAAGACGGCACTAACAGTGGCCCTCCTTTAAGTTAATGTTAATATATGATAAGGCAGCGTCATTTTGGCGATATCACCGTAGGATGGGTTT
TCCAACGGATGCATGCATTTCCGTTCTAAGATCCCTGCTGGGCCCGTTGGAAATGGTCTCCACTAGGGA